ID: 936080457

View in Genome Browser
Species Human (GRCh38)
Location 2:109429305-109429327
Sequence GCACCCAGAGGAAAAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936080448_936080457 14 Left 936080448 2:109429268-109429290 CCCAGCACATCCATCTGCTTTTG 0: 1
1: 0
2: 3
3: 26
4: 226
Right 936080457 2:109429305-109429327 GCACCCAGAGGAAAAAAAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 258
936080451_936080457 4 Left 936080451 2:109429278-109429300 CCATCTGCTTTTGGTGTCCCCTA 0: 1
1: 0
2: 1
3: 12
4: 197
Right 936080457 2:109429305-109429327 GCACCCAGAGGAAAAAAAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 258
936080449_936080457 13 Left 936080449 2:109429269-109429291 CCAGCACATCCATCTGCTTTTGG 0: 1
1: 0
2: 2
3: 30
4: 429
Right 936080457 2:109429305-109429327 GCACCCAGAGGAAAAAAAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 258
936080447_936080457 26 Left 936080447 2:109429256-109429278 CCAGAAAACAGACCCAGCACATC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 936080457 2:109429305-109429327 GCACCCAGAGGAAAAAAAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936080457 Original CRISPR GCACCCAGAGGAAAAAAAGT AGG Intronic