ID: 936081935

View in Genome Browser
Species Human (GRCh38)
Location 2:109438232-109438254
Sequence TTGCCCACCCAAGTGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936081925_936081935 29 Left 936081925 2:109438180-109438202 CCTTATCTTAGCTGATGGGACAA 0: 1
1: 0
2: 1
3: 10
4: 163
Right 936081935 2:109438232-109438254 TTGCCCACCCAAGTGGGTGCAGG 0: 1
1: 0
2: 1
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936081935 Original CRISPR TTGCCCACCCAAGTGGGTGC AGG Intronic
900826454 1:4931003-4931025 ATGCCCTCCCATGTGGGTGAAGG + Intergenic
901230833 1:7640942-7640964 TTGCCCATCCACGTGGGATCTGG + Intronic
901747778 1:11385883-11385905 GTGCCCACCCACATGGGTGAGGG + Intergenic
902286673 1:15411754-15411776 CTGCCCAGCCAAGCGGGAGCCGG - Intronic
902368387 1:15991420-15991442 GAGCCCTCCCAAGTGGGTCCTGG - Intergenic
903467279 1:23560353-23560375 TTGCTGACCCAATTGGGTGGGGG - Intergenic
904407595 1:30303236-30303258 TTCCCCAGCCAAGTGGCAGCTGG + Intergenic
904461791 1:30685086-30685108 TTTCCCAGCCAAGAGGCTGCTGG - Intergenic
907722469 1:56984558-56984580 ATGCCCACCCACCTGGCTGCTGG - Intergenic
909531446 1:76686320-76686342 TTGCCCACTCAAGTAAATGCAGG + Intergenic
912497885 1:110103041-110103063 TTGCCCAGCCAAGGGGCTGGAGG + Intergenic
914755154 1:150558156-150558178 TTGCCCAGGCAAGGAGGTGCTGG + Intronic
915507998 1:156369425-156369447 TTCGCTACCCAAGTGAGTGCGGG + Exonic
918346141 1:183609110-183609132 TTACCTCCCCAAATGGGTGCTGG - Intergenic
918996493 1:191768119-191768141 TTGAGAACCCAAGTGGCTGCTGG + Intergenic
919766417 1:201130136-201130158 GTGCACACCTAAGTGGGTGTGGG - Intergenic
1065090140 10:22223823-22223845 TTGCCCTCCCCAGTGTGGGCAGG + Intergenic
1065704965 10:28464269-28464291 TTCCCCAGCCAAGTGGATCCTGG - Intergenic
1075650854 10:124127798-124127820 TGGCCCAACCAAGGGGGTGCAGG + Intergenic
1079561988 11:21833059-21833081 TTGATCACCCAAGTGTGTACTGG - Intergenic
1081670132 11:44938162-44938184 CTGGCCTCCCCAGTGGGTGCCGG + Intronic
1081725432 11:45324175-45324197 TGGCCCACGCTATTGGGTGCAGG - Intergenic
1087128669 11:94650726-94650748 TTGCCCACCCAGCCGGGTGGTGG - Intergenic
1089625679 11:119749273-119749295 TTGCCCACACTAGTGAGGGCAGG - Intergenic
1096148735 12:49295864-49295886 TTACCAACCCAGGTGTGTGCGGG + Intronic
1096458666 12:51808866-51808888 TTGCCCACAGAGGTGGGTGAGGG + Exonic
1097985242 12:65776005-65776027 TTTCCCTTCCATGTGGGTGCAGG - Intergenic
1100990690 12:100248306-100248328 TTGCCCAGACAATTTGGTGCTGG + Intronic
1103960918 12:124608854-124608876 TTTTCAAGCCAAGTGGGTGCAGG + Intergenic
1112016076 13:95332511-95332533 GTGCCCACCCATGTTGGTGAAGG - Intergenic
1116135449 14:40917295-40917317 TTGCCCTCCCCAGTGTGTGTGGG - Intergenic
1118899301 14:69973187-69973209 TTTCCCACCCAAGTCTGTGGAGG + Intronic
1121111634 14:91316928-91316950 TTGCCCATGCCAGTGGCTGCAGG - Intronic
1122887653 14:104717635-104717657 TTGCGCCCCCAAGTAGGTCCAGG + Intronic
1130296943 15:82654020-82654042 AAGCTCACTCAAGTGGGTGCCGG + Intergenic
1136174407 16:28507221-28507243 TTGCCCACCCGAGGGGATTCGGG + Intronic
1139703892 16:68727044-68727066 GTGCCCATCCACGTGGGTGTGGG - Intergenic
1139917049 16:70435027-70435049 TTCCCCAACCAAGTGGGTTGGGG - Intronic
1141731428 16:85825502-85825524 CTGCCCAGCCACGTGGGGGCAGG + Intergenic
1142760808 17:2041091-2041113 TTCCCTTCCCAGGTGGGTGCAGG + Exonic
1146948322 17:36889061-36889083 TTGCCCAGCCAAGGAGGAGCTGG + Intergenic
1147657247 17:42098013-42098035 TTCCCCACCCTAGGGGGTGATGG - Intergenic
1148857696 17:50587721-50587743 TTGCCCAGCCAAGTGACTCCAGG - Intronic
1149221276 17:54417838-54417860 CTGTCCTCCCAAGTGGGAGCTGG - Intergenic
1150271654 17:63870000-63870022 TTAGCCACCCAAGTAGGCGCTGG + Intergenic
1150275190 17:63892897-63892919 TTAGCCACCCAAGTAGGCGCTGG + Intergenic
1150277332 17:63907648-63907670 TTAGCCACCCAAGTAGGCGCTGG + Intergenic
1150814623 17:68383369-68383391 TTGCCCACCCCAGTGCCTTCTGG + Intronic
1152519124 17:80845215-80845237 TAGCCCAGCCACGTGAGTGCAGG - Intronic
1160460139 18:79032905-79032927 TTGGCCAGCCCAGTGGGAGCTGG - Intergenic
1162335702 19:10058952-10058974 TTGCCAGCCCTAGTGGGTGTGGG + Intergenic
1164578586 19:29420491-29420513 GTGCCCTCTCAAGTGGGTGCAGG + Intergenic
1164594736 19:29525778-29525800 CTCCCAACCCAAGCGGGTGCGGG + Intergenic
1165952306 19:39481165-39481187 CCTCCCACCCACGTGGGTGCCGG + Intronic
1167210441 19:48130853-48130875 GTGCTCAGCCAAGTCGGTGCTGG + Intronic
936081935 2:109438232-109438254 TTGCCCACCCAAGTGGGTGCAGG + Intronic
937238985 2:120448067-120448089 TTGTACAGCCAAGTGGGGGCCGG + Intergenic
938204292 2:129404156-129404178 TTGCCCTCCCCAGTGTGGGCAGG + Intergenic
939652867 2:144785939-144785961 CTGCCTCCCCAAGTGGGTCCTGG + Intergenic
946408449 2:219505027-219505049 GCACCCACCCAAGTGGGGGCTGG + Intronic
1180758208 22:18177890-18177912 TCCCCCACCCAGGTTGGTGCCGG - Intergenic
1180777814 22:18500709-18500731 TCCCCCACCCAGGTTGGTGCCGG + Intergenic
1180802570 22:18638687-18638709 TGGCCAGCCCAAGTGTGTGCAGG - Intergenic
1180853809 22:19034243-19034265 TGGCCAGCCCAAGTGTGTGCAGG - Intergenic
1180968152 22:19801169-19801191 TTGCCCAGTCTAGTGGGTGAAGG - Intronic
1181080091 22:20408109-20408131 TTCCCCTCTCCAGTGGGTGCTGG - Exonic
1181219153 22:21356574-21356596 TGGCCAGCCCAAGTGTGTGCAGG + Intergenic
956702198 3:71968220-71968242 ATGCCCAGCCAAGCGGGTGAAGG + Intergenic
958595421 3:96216313-96216335 GTGCCCTCCCAAGTGGCAGCTGG - Intergenic
963173997 3:142279843-142279865 TTGGCCACCCATCTGAGTGCTGG + Intergenic
978344460 4:107752485-107752507 ATGCCCACCCACATGGGTGAAGG + Intergenic
979934102 4:126670403-126670425 CTGCCCCCTCAAGTGGGTCCCGG + Intergenic
980764931 4:137289540-137289562 ATGCCCACCTACGTGGGTGAGGG + Intergenic
988042910 5:25911395-25911417 TTGCCCAGGGAAGTGGGTGGGGG - Intergenic
997461221 5:134053674-134053696 TTGCCCAGCAAAGTGGAGGCTGG - Intergenic
1001670361 5:173468485-173468507 ATTCCCACCCAAGTGGGTGCTGG - Intergenic
1002001567 5:176199271-176199293 TTGCCATCCCCAGTGGGCGCTGG + Intergenic
1002131976 5:177087295-177087317 TTGCCCACCGAGGCGGGGGCAGG + Intronic
1002252774 5:177939709-177939731 TTGCCATCCCCAGTGGGCGCTGG - Intergenic
1005188053 6:23184793-23184815 TAGCCCTCCCCAGTGGGTGAAGG + Intergenic
1005265435 6:24107554-24107576 TTGCTCACCCACATGGGTGGGGG - Intergenic
1008513758 6:52300409-52300431 TTTCCAACCCCAGTGGGTGATGG - Intergenic
1010278857 6:74000909-74000931 TTGCCCACACAAGTGCATCCAGG - Intergenic
1013060096 6:106625288-106625310 TTGCCCACAGGAGTGGGTGCGGG - Intronic
1017033033 6:150241048-150241070 GTGGGCACCTAAGTGGGTGCTGG + Intronic
1017114937 6:150967509-150967531 TTCCCCACCCACGTGGCTCCTGG - Intronic
1022544357 7:31172036-31172058 TCTCCCATCCAAGTGAGTGCCGG - Intergenic
1023274404 7:38502648-38502670 TTGCACAGCCAAGTGGTGGCAGG - Intronic
1024056194 7:45661119-45661141 TTGTGCACCCCAGTGGATGCAGG + Intronic
1024450965 7:49542553-49542575 TTCCCAGCCCCAGTGGGTGCAGG + Intergenic
1027046561 7:74995015-74995037 TTGGCCAGCCATGTGGGTCCAGG + Intronic
1029248881 7:99222035-99222057 GTGCCCTCCCAAGAGGGTGACGG - Intergenic
1029386423 7:100246587-100246609 TTGGCCAGCCATGTGGGTCCAGG - Intronic
1033942899 7:146677859-146677881 TTGCCCCCAGACGTGGGTGCAGG + Intronic
1034713535 7:153218551-153218573 GTGCCCACCCACGTTGGTGAGGG + Intergenic
1037356217 8:18022480-18022502 TTGCTCACCCAAGTGTGTGTGGG - Intronic
1039493979 8:37967009-37967031 GAGGCCACCCAAGTGGATGCGGG - Intergenic
1042965518 8:74347879-74347901 TTGCAGACCCAAGTTGGTGTGGG + Intronic
1047965179 8:130041180-130041202 TTCCCCTCCTAATTGGGTGCAGG + Intergenic
1049634879 8:143682391-143682413 ATGCCCAGCCAAATGGGGGCAGG - Intergenic
1053287281 9:36858033-36858055 CTGCCCAGCTAAGTGGCTGCTGG - Intronic
1059804648 9:117785384-117785406 TTGCCCACCCAAGTCTGAGATGG + Intergenic
1060904654 9:127294103-127294125 TTGCCTACCCCAGTGGGTCTTGG + Intronic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1188483262 X:30655362-30655384 TTGCCCACACAAATGCCTGCAGG + Intronic
1189490653 X:41469248-41469270 TTGCCTACCCAAGTCCCTGCAGG - Intronic
1191870322 X:65740055-65740077 TTGCCCAGGGAAGTGGGTGGGGG - Exonic
1194923534 X:99796231-99796253 CTGCCCAGCCATTTGGGTGCAGG - Intergenic
1200819370 Y:7566526-7566548 TAGCCACCCCAAGTGAGTGCTGG - Intergenic