ID: 936084294

View in Genome Browser
Species Human (GRCh38)
Location 2:109456009-109456031
Sequence GGCCAAGGGGCTCCGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936084294_936084303 22 Left 936084294 2:109456009-109456031 CCTGCTCACGGAGCCCCTTGGCC 0: 1
1: 0
2: 0
3: 22
4: 169
Right 936084303 2:109456054-109456076 CCACAGTCTGATGCATCGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 102
936084294_936084301 21 Left 936084294 2:109456009-109456031 CCTGCTCACGGAGCCCCTTGGCC 0: 1
1: 0
2: 0
3: 22
4: 169
Right 936084301 2:109456053-109456075 GCCACAGTCTGATGCATCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 105
936084294_936084298 -6 Left 936084294 2:109456009-109456031 CCTGCTCACGGAGCCCCTTGGCC 0: 1
1: 0
2: 0
3: 22
4: 169
Right 936084298 2:109456026-109456048 TTGGCCCATGCTCTGTCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 164
936084294_936084304 30 Left 936084294 2:109456009-109456031 CCTGCTCACGGAGCCCCTTGGCC 0: 1
1: 0
2: 0
3: 22
4: 169
Right 936084304 2:109456062-109456084 TGATGCATCGCTGGGCTCCCAGG 0: 1
1: 0
2: 1
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936084294 Original CRISPR GGCCAAGGGGCTCCGTGAGC AGG (reversed) Intronic
900638992 1:3679342-3679364 GGTCCAGGGGTTCCGTGAACAGG - Intronic
901703298 1:11056785-11056807 GGCCAAGGGGCTGGGGGACCTGG + Intronic
902505444 1:16936796-16936818 GGACAAGGTGCTCCGCGAGAAGG + Exonic
904475906 1:30764389-30764411 GGCCAAGGGGCTTGGAGGGCTGG + Intergenic
904916369 1:33973333-33973355 GGCCAAGGGGCTTCCTGCACAGG + Intronic
905075642 1:35268767-35268789 CTCCAAGGGGCCCCGTGAGTAGG - Intergenic
907159159 1:52358650-52358672 GGCCTAGGGGCTCTGTGAGGAGG - Intronic
909197865 1:72649420-72649442 GACCTAGGGGCTCCCTGAGCTGG + Intergenic
911078892 1:93909121-93909143 GGCCAAGGCGCTCCTGGCGCGGG - Exonic
911091713 1:94022504-94022526 GGCTAAGGGCCTCCCTGAACAGG - Intronic
912385924 1:109271142-109271164 GGCCACGGGGCCCTGTGGGCTGG + Intronic
913255021 1:116945157-116945179 GGCCATGGGGCTCCCTGGCCCGG - Intronic
914751490 1:150537879-150537901 GGACAGGGGGCGCTGTGAGCAGG + Intergenic
914764072 1:150622666-150622688 GCCCAAGGGGCTCCATGTGCTGG + Intronic
919784781 1:201252235-201252257 GGGCATGGGGCTCCATGAGCTGG - Intergenic
919981808 1:202646488-202646510 GGCCAGTAGGCTCGGTGAGCAGG - Intronic
922291298 1:224210929-224210951 GGCCAAGGGTGTGCGTGAGTGGG - Intergenic
1063165209 10:3455435-3455457 TGCCAAGGGGCACGGTGAACAGG - Intergenic
1063772057 10:9214821-9214843 GGCCAAGAGGATGCGCGAGCAGG + Intergenic
1067036689 10:42926021-42926043 GGCGAAGGGGGTCAGAGAGCAGG - Intergenic
1067497388 10:46773337-46773359 GGCTGAGGGGCTCCATGAGCAGG - Intergenic
1067597263 10:47567078-47567100 GGCTGAGGGGCTCCATGAGCAGG + Intergenic
1070140612 10:73734688-73734710 GGCTAAGGGGCTCCAAGAGCAGG + Intergenic
1070891787 10:79946608-79946630 AGCCCAGGGGCTGTGTGAGCAGG + Exonic
1071295131 10:84214083-84214105 AGCCATGGGGCTCCGGGAGAGGG - Exonic
1074901887 10:117824135-117824157 GGCCATGGTGCTCCATGACCTGG - Intergenic
1075716801 10:124560525-124560547 GGCCACGGCGCTCCCTGAGCAGG - Intronic
1076845562 10:133067975-133067997 GAGCAGGGGGCTCCGGGAGCAGG - Intergenic
1077249660 11:1555418-1555440 GGCTGAGGGGCTCTGTGAGCAGG - Exonic
1077390064 11:2296708-2296730 GGCCACAGGGCTCCATGGGCTGG + Intronic
1079117613 11:17650622-17650644 GGTTAAGGGGGTCTGTGAGCAGG - Intergenic
1083842088 11:65310360-65310382 GGCCCAGGGGATCCCTGAGGAGG - Intergenic
1084430120 11:69106388-69106410 TGCCGAGGGGCTCTGTGGGCAGG + Intergenic
1084871800 11:72103348-72103370 GGCCAAGCGGCTCCGGGACAGGG - Exonic
1085395532 11:76205372-76205394 GGCAGAGGGGCTCCCTGAGAGGG - Intronic
1089291796 11:117441751-117441773 TGCCAAGGGGCTCTCAGAGCAGG + Intronic
1089454045 11:118615506-118615528 GTCCCAGGGGCTCTGTCAGCGGG + Intronic
1090412392 11:126518263-126518285 GGCCCAGCGGCTCTGCGAGCTGG + Intronic
1090846787 11:130536251-130536273 GGCCAAGGGGCTGCAGGAGAGGG + Intergenic
1091508943 12:1101858-1101880 GGCCTACGGGCTCCATCAGCAGG - Intronic
1094461851 12:30704657-30704679 GGCCAGAGGGGGCCGTGAGCAGG + Intergenic
1094844217 12:34354375-34354397 GCCCAAGGTGCTCCGTGGGCGGG + Intergenic
1094853822 12:34394112-34394134 GGCAGAGGTGCTCTGTGAGCAGG - Intergenic
1094854053 12:34395058-34395080 GGCCAAGATGCTCTGTGGGCAGG - Intergenic
1102097696 12:110253324-110253346 GGCCACTGGGCCTCGTGAGCTGG + Intergenic
1103629588 12:122248820-122248842 GGCCAAGGGTCTCCCTCAGAGGG - Intronic
1103938487 12:124489159-124489181 GCCCAAGGGGTCCCATGAGCTGG + Intronic
1103945063 12:124521329-124521351 GGCCCCAGGGCTCCGTGACCTGG + Intronic
1105064012 12:133181378-133181400 GGCCAAGGGCCACCGGGAGGGGG - Intronic
1105280662 13:18960824-18960846 TGCCAAGGGGCGCCATGAGGTGG - Intergenic
1105839212 13:24239016-24239038 GGTCCAGGGCCTCCCTGAGCAGG - Intronic
1106101512 13:26697711-26697733 GCCCCAAGGGCTCCCTGAGCAGG + Intergenic
1111232520 13:85363025-85363047 GGCCAAAGGGCTCCTCAAGCCGG - Intergenic
1117920296 14:60721728-60721750 GGCAAGGGGGCACCGCGAGCAGG - Intronic
1122353157 14:101109090-101109112 GGCCAGGGGGCCCCGTGCTCCGG - Intergenic
1122403376 14:101480891-101480913 GGGCGGGGGGCTCCGGGAGCAGG + Intergenic
1122637221 14:103135807-103135829 AGCCCAGGGCCGCCGTGAGCGGG + Exonic
1122651662 14:103229942-103229964 GGCCAGGCGGCCCCGTGGGCAGG + Intergenic
1125175616 15:36818386-36818408 GGAAAAGGGGCGCAGTGAGCTGG + Intergenic
1126352970 15:47764368-47764390 GGCCAAGCTGCTCCCTGAGGAGG - Intronic
1128062359 15:64743070-64743092 CACTAAGGGGCTCCCTGAGCTGG - Intronic
1128556707 15:68636596-68636618 GCCCAAGGGGCCCTGTGAGTTGG + Intronic
1128685488 15:69681347-69681369 GGCAGTGGGGCTCCGTGGGCAGG + Intergenic
1129475631 15:75782998-75783020 GGACGAGAGGCTCCGAGAGCAGG + Intergenic
1130431289 15:83849659-83849681 GGCCAAGGGGGTCCTTTACCAGG + Intronic
1131519222 15:93100676-93100698 AGCCAAGGTGCTCCGTAAGATGG - Intergenic
1132803417 16:1765012-1765034 GGCCAAGGAGCTCCCTGAAATGG + Exonic
1133030805 16:3010124-3010146 GCCCCAGGGGCTGGGTGAGCTGG + Intergenic
1133046835 16:3092746-3092768 GGCCACGGGCGTCCCTGAGCCGG - Exonic
1136094819 16:27947849-27947871 GTGCAAAGGGCTCCGAGAGCCGG - Intronic
1136385945 16:29926085-29926107 GGCCGAGGGTCTTCGGGAGCAGG - Exonic
1139783426 16:69370470-69370492 GGCCAAGGCGCACCGTGAGGAGG + Exonic
1142117736 16:88368771-88368793 GATCAAGGAGCTCAGTGAGCTGG - Intergenic
1142157619 16:88539794-88539816 GGCTGGGGGGCTGCGTGAGCTGG + Intergenic
1142364985 16:89645478-89645500 GGCCAGGGGGCTCAGCCAGCTGG + Exonic
1143140272 17:4738667-4738689 GGAGATGGGGCTCGGTGAGCCGG + Intronic
1145982267 17:29020016-29020038 GGCCGTGGGGCTCCGGGTGCGGG + Intronic
1147661149 17:42117752-42117774 TGCCAAGCGGCTCCGTGTGATGG - Exonic
1148371033 17:47100111-47100133 GGCCGAGGGGCCCGGGGAGCGGG - Intergenic
1150625477 17:66838444-66838466 GGCCATGGGCTGCCGTGAGCAGG - Intronic
1151746462 17:76014318-76014340 GGCCCAGGGCCTCCGTGGCCTGG + Intronic
1151791217 17:76307212-76307234 GGCCTAGGGCCTCCCCGAGCTGG - Intronic
1151797771 17:76357874-76357896 GACCATGTGGCTCCCTGAGCTGG + Intronic
1152699170 17:81810757-81810779 GGAGAAGGGGCTCCCTCAGCAGG - Intronic
1152739024 17:82011082-82011104 GGACCACGGGCTCCCTGAGCTGG - Intronic
1153180779 18:2430268-2430290 GTCCAAGGGGCTGTGTGACCTGG - Intergenic
1156271914 18:35543075-35543097 GGCCAGAGGGTTACGTGAGCTGG - Intergenic
1157204474 18:45687056-45687078 GGCCAAGGCGCTCACTCAGCAGG - Intergenic
1160726908 19:621411-621433 GGCCGAGCTGCGCCGTGAGCTGG - Exonic
1161021865 19:2014709-2014731 GGCCCAGGGGCTCCAAGTGCAGG + Intronic
1161106132 19:2444948-2444970 GGCCAAGGGGCTGCATGTCCAGG - Intronic
1161393576 19:4033393-4033415 GGGGGAGGGGCTGCGTGAGCAGG - Intronic
1161435027 19:4258102-4258124 GGGCAGGGGGTTCCCTGAGCAGG + Intronic
1161816358 19:6502140-6502162 GGCCAAGGTGCTCGGGGAACGGG - Exonic
1162440950 19:10691763-10691785 GGCCATGGAGGTCCGTGAGCTGG + Exonic
1162746199 19:12800135-12800157 GGGCAGGGCGCTCCCTGAGCCGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163729282 19:18940349-18940371 GGCCACGGGGCTCCCGGAGGGGG + Intronic
1163770829 19:19190132-19190154 TGCCAAGGTCCTCCGTGAGGTGG - Intronic
1164632165 19:29768962-29768984 GTGCAAGGGCCTCCCTGAGCAGG + Intergenic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1167092382 19:47353486-47353508 GGCCAAGCTGCAGCGTGAGCGGG + Exonic
1167369216 19:49070991-49071013 CGCCAAGGCCCTCCGTGACCTGG + Intronic
1167511561 19:49897769-49897791 GAGCCAGGGGCTCCGTGAGGAGG + Intronic
927215785 2:20667224-20667246 GGTCCATGGGCTCCGTGGGCCGG - Exonic
931746000 2:65292571-65292593 CGCCCAGGGGCTGTGTGAGCAGG - Intergenic
932234931 2:70113299-70113321 GGGAAAGGGGCTCAGTGAGCTGG - Intergenic
932252795 2:70258781-70258803 AGCCAAGGGCCTCTGAGAGCAGG - Intronic
932568473 2:72924243-72924265 AGAGAAGGGGCGCCGTGAGCCGG - Intronic
934556051 2:95287539-95287561 CCCCAAGGGGCTCCGGGGGCGGG - Intronic
936084294 2:109456009-109456031 GGCCAAGGGGCTCCGTGAGCAGG - Intronic
938093794 2:128449001-128449023 TGCCAAGGGGCACCCTGACCCGG - Intergenic
946253780 2:218429296-218429318 GGCCAAGGAGATCCGAGACCAGG + Exonic
946378573 2:219329241-219329263 GGCCAGGGGGCTCTGTGAGGAGG + Exonic
946495663 2:220192987-220193009 GACCTAGGAGCTCCCTGAGCTGG + Intergenic
947245427 2:228042180-228042202 GACCAATGGGCTCTGTGAGTAGG + Intronic
948336631 2:237213484-237213506 GACCAAGGGTCTGTGTGAGCTGG + Intergenic
948809152 2:240466136-240466158 GGTCAAGGGCGTCCGGGAGCTGG - Exonic
1170368039 20:15618622-15618644 GCCCAAGGGGCTCCATGTGCTGG + Intronic
1173246418 20:41340754-41340776 GGCCAAAGGGCGCCCTGGGCGGG + Intergenic
1173580334 20:44142537-44142559 GGCCAGGGGGCTGCGTCAGGGGG - Intronic
1175942724 20:62545422-62545444 AGCCAAGGTGCTCCGTGGGGAGG - Intergenic
1176390063 21:6158762-6158784 GGCCAAGGGGCTTCTAGAGAAGG + Intergenic
1178327752 21:31659523-31659545 GGCCAAGGGGCCGCGTGCGCCGG - Intergenic
1178499390 21:33113220-33113242 TGCCAAGGGGAACCGTGCGCTGG - Intergenic
1179479262 21:41667250-41667272 AACCAAGGCTCTCCGTGAGCTGG - Intergenic
1179733403 21:43379478-43379500 GGCCAAGGGGCTTCTAGAGAAGG - Intergenic
1181546264 22:23604233-23604255 GGCCAAGGTGGTCTGAGAGCAGG - Intergenic
1184033344 22:41907350-41907372 AGCCAAGGGGCTGCGTGACTTGG + Intergenic
1185175116 22:49321959-49321981 GGCCGAGAGTCTCCGGGAGCCGG + Intergenic
952889057 3:38029215-38029237 GGACAAGGGGGTCCGCGAGGCGG + Intronic
954428048 3:50453971-50453993 GGAGATGGGGCTCCGTGAGGCGG - Intronic
954797275 3:53168051-53168073 GGCCAAGGGGAGCCCTGAGGGGG - Intronic
964790528 3:160450092-160450114 GGCCAGTGGGCCTCGTGAGCTGG + Intronic
968285922 3:197508703-197508725 GGCCAAGAGGCTGTGTGAGCAGG - Intergenic
968655247 4:1775762-1775784 GGCCAATGGGCTTTGTGGGCTGG - Intergenic
969113236 4:4856433-4856455 GGCCCAGGGGTTCAGCGAGCAGG - Intergenic
969129622 4:4981976-4981998 GGCCAAGGGGCGACATCAGCAGG + Intergenic
969410610 4:7025629-7025651 GGCCACGGGGCTCAGTAAGTGGG - Intronic
973737390 4:53885874-53885896 GGCCAAAAGGCTCCCTGAGGAGG + Intronic
982797070 4:159659147-159659169 GGGCAAGGGGCTGGGTGAGGAGG - Intergenic
985129727 4:186727005-186727027 GCCGGAGGGGCTCCGCGAGCCGG - Intergenic
986273712 5:6255751-6255773 GGCCCAGGGCCTCTGTGAGAGGG - Intergenic
986305296 5:6509708-6509730 GGGCAAGGGGGTCCGGGAGCTGG - Intergenic
987061361 5:14246938-14246960 GGCAAAGGGACTCAGTGAGCAGG - Intronic
996529931 5:124518035-124518057 GACCAAGGGACACAGTGAGCAGG - Intergenic
997319104 5:132963379-132963401 GGGCGAGGGGCTCCGGGAGGCGG + Exonic
997470511 5:134114715-134114737 GGCAGAGCGGCTCCGCGAGCTGG - Exonic
999696205 5:154190546-154190568 GGCCGAGACGCTCCGTGAGAGGG + Intronic
1001114830 5:168930824-168930846 GGCCAAGGGACTCAGTGTCCTGG - Intronic
1001734956 5:173989827-173989849 GGCCAAAAGCCTCCGTGAGGGGG - Intronic
1002107529 5:176887505-176887527 GGCCAAGGGGCTCCGAGGGGAGG - Exonic
1016261292 6:142173959-142173981 GGCAAAGGGGCTTAGGGAGCAGG - Intronic
1018937592 6:168283846-168283868 GGCCGAGCGGCTGGGTGAGCTGG - Intergenic
1019453739 7:1113842-1113864 GGCAAAGGGGCTCCAGGACCCGG + Intronic
1019733575 7:2639903-2639925 AGCCACGGGGCACGGTGAGCAGG - Intronic
1020112709 7:5456473-5456495 GCCCAAGGGGCCCTGAGAGCAGG + Intronic
1025118810 7:56281719-56281741 GGCAAAGAGGCTTCCTGAGCTGG - Intergenic
1026909364 7:74083624-74083646 GGCCTGGGGGCGCCGCGAGCTGG - Intronic
1029423403 7:100483391-100483413 GGCCGAGGGGCTCCGAGGGTGGG - Intergenic
1030121170 7:106112160-106112182 AGCCGAGTGGCTCCTTGAGCGGG + Exonic
1036802549 8:11803017-11803039 GGGCAAGGGGCGCGGCGAGCAGG + Intronic
1037885051 8:22591572-22591594 GGACTGGGGGCTCAGTGAGCTGG - Exonic
1037887956 8:22604900-22604922 GGCCGAGGGGCTGCGAGGGCCGG + Intronic
1037936719 8:22919905-22919927 AGCCAAGGAGCTCCCAGAGCAGG + Intronic
1038911760 8:31972619-31972641 GGCCAAGAGAGTCAGTGAGCTGG - Intronic
1039918443 8:41876295-41876317 GGCCGAGGGGCTGCGCGACCGGG - Intronic
1040026535 8:42786857-42786879 GGCCCAGGTGCTCCGAGTGCGGG - Intronic
1042608932 8:70576980-70577002 GATCTAGGGGCTCCCTGAGCAGG - Intronic
1045251610 8:100487439-100487461 GGAGGAGGGTCTCCGTGAGCAGG + Intergenic
1049560273 8:143306857-143306879 CCCCAAGGGGCTCCGGCAGCAGG - Intronic
1049684641 8:143934406-143934428 AGCCAGGGGGCACCTTGAGCTGG + Exonic
1049687923 8:143946405-143946427 GGCCAGGCTGCTCCGAGAGCCGG + Intronic
1049791726 8:144475413-144475435 GGGCAAGGGGCTCCCGGAGAAGG + Intronic
1055488950 9:76784711-76784733 GGCCCAGGGGATCTGTGAACAGG + Intronic
1057297920 9:93860136-93860158 GGCCAGGGCGGCCCGTGAGCAGG + Intergenic
1059425758 9:114220055-114220077 GACCCAGGGGCTCAGTGGGCTGG - Intronic
1060757302 9:126223097-126223119 GCCCAGGGGGCTCCTTGAGAGGG - Intergenic
1061168830 9:128940394-128940416 GGCCCAGGGGCTCCGTGTACAGG - Exonic
1061208380 9:129177175-129177197 GGCCAGGGCGCTCCGGGACCGGG - Exonic
1061419546 9:130465967-130465989 GGCCAAGCTGCTCCAGGAGCTGG + Intronic
1061490187 9:130940042-130940064 GGCCAAGGCGCCCCGGGAGCCGG - Intergenic
1061570614 9:131475575-131475597 GGCAGAGGGGCTCCGAGAACGGG + Exonic
1061925927 9:133806047-133806069 GGCCAAGGAGCCCCAGGAGCCGG + Intronic
1062049961 9:134442177-134442199 GGCCCTGGGGCTTCGGGAGCTGG + Intergenic
1062216374 9:135391911-135391933 GCCCAAGGGGCTGAGAGAGCGGG - Intergenic
1062329204 9:136029588-136029610 GACCCAGGAGGTCCGTGAGCCGG + Intronic
1062473686 9:136717549-136717571 GGGGAAGGGGCTGCGTGAGGAGG - Intronic
1203783000 EBV:111378-111400 GGTGGAGGAGCTCCGTGAGCAGG - Intergenic
1186625845 X:11292601-11292623 GGCCAAGCTGCTCTGTGAGATGG + Intronic
1190017195 X:46837074-46837096 GGCCAACGAGCTCCGCGGGCTGG + Exonic
1198312081 X:135433815-135433837 GGACAAGGTGCTCCATGAGAAGG + Intergenic