ID: 936084543

View in Genome Browser
Species Human (GRCh38)
Location 2:109457767-109457789
Sequence TGCCCAGAAAAACTCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936084543 Original CRISPR TGCCCAGAAAAACTCAGTGA TGG Intronic
902208017 1:14883993-14884015 TGCCCACAAAATCCCAGTAAGGG + Intronic
902305742 1:15537708-15537730 TCCCCAGAGCAACTCAATGAAGG + Intronic
902306803 1:15547106-15547128 TCCTCAGAAGAACCCAGTGATGG + Intronic
903619559 1:24688086-24688108 TGCTCACAAAAACCCTGTGAAGG - Intergenic
905344139 1:37300081-37300103 TGCCCAGATACACTGAGTGATGG + Intergenic
906850508 1:49244374-49244396 TGCCCAGAAAGACTGAGAGAAGG + Intronic
907804581 1:57805512-57805534 TGCATAGAATAACTCAGAGAAGG + Intronic
910002875 1:82359221-82359243 TGCCAATACAAACTCAGTTATGG - Intergenic
910436402 1:87210324-87210346 TGCCCAGCACAAGTCAGTGAAGG - Intergenic
910843727 1:91585859-91585881 TGCGCAGGAAAACTAAATGAGGG + Intergenic
912067774 1:105766608-105766630 TGCCATGAAAACCTCAGTAAAGG + Intergenic
915334731 1:155134457-155134479 TGCCCAGATGAACTGACTGAAGG + Exonic
916730091 1:167558352-167558374 TCCCCATAAAAATCCAGTGAAGG - Intergenic
917344734 1:174017892-174017914 TGCACAGTAATAATCAGTGAAGG + Intronic
918046803 1:180946453-180946475 TGCCCTGAAAGACTCATGGATGG - Exonic
918096131 1:181335619-181335641 GGCCCAGAAAAAGGCAGTGGTGG + Intergenic
918471990 1:184884564-184884586 GGACCAGAACAACTCAGCGAGGG + Intronic
918637479 1:186795769-186795791 TCCCCAGAATCAATCAGTGATGG + Intergenic
918637526 1:186796264-186796286 TCCCCAGAATCAATCAGTGATGG + Intergenic
922543405 1:226435730-226435752 TGCTCAAAAACACTCAGGGAAGG + Intergenic
924670793 1:246122826-246122848 TGCACTGAAAAACACAATGAAGG + Intronic
1062982659 10:1737828-1737850 TGCTCAGAAAGACACAGGGACGG + Intergenic
1063455816 10:6182192-6182214 TGCCCAGAAAAGCCAGGTGAGGG - Intronic
1063961077 10:11305803-11305825 TGCCCAGATAAGCTCACTGTTGG - Intronic
1064218729 10:13421427-13421449 TCCCCAGCAAATCTCAGTGGAGG - Intergenic
1064468936 10:15615326-15615348 TCCCAAGACAAACTCAGAGAGGG - Intronic
1065849250 10:29773162-29773184 CGCCCAGAGATACTTAGTGAAGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1074873461 10:117595832-117595854 TGCCCAGAACATCGCAGAGAAGG + Intergenic
1075630549 10:123998279-123998301 TGCTCAGAAAATGTCAGTGTGGG + Intergenic
1075898256 10:126017007-126017029 TGCCATGGAAAACTCAGTGATGG + Exonic
1075997794 10:126892596-126892618 TGAGCAGCAAAACTCAGGGATGG + Intergenic
1076775355 10:132693210-132693232 TGCCCAGTAAAAGCCAGAGAAGG + Intronic
1077225012 11:1435865-1435887 TGTCCAGAACAGCTCAGTGCTGG - Intronic
1079234402 11:18677610-18677632 TTCCCACAAAAACTCTCTGAGGG + Intergenic
1080154886 11:29098030-29098052 TACCCAGAGAAAATAAGTGAGGG + Intergenic
1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG + Intergenic
1083548789 11:63569399-63569421 TGCACAGAAAAAGTCAGTTTGGG - Intergenic
1085060945 11:73446531-73446553 TACCCCCAAGAACTCAGTGAAGG + Intronic
1085834728 11:79940487-79940509 TTCCCAAAAAAGCCCAGTGAAGG + Intergenic
1086334966 11:85791311-85791333 TACCCAGCAAAGCTGAGTGAGGG - Intronic
1089346290 11:117793847-117793869 TGCCCAGAAAAACGAAGCGTCGG + Intronic
1090952575 11:131486559-131486581 TGACCAGAAAAACTCAATCTGGG - Intronic
1091822173 12:3483655-3483677 TGCTCAGACATACGCAGTGATGG - Intronic
1091859549 12:3767955-3767977 TGCTCAATAAAACTCAGAGAAGG + Intergenic
1093137417 12:15468881-15468903 GACCCAGAAAACCTTAGTGAAGG + Intronic
1093616979 12:21237552-21237574 TGACCAGAAAAACTACGTGTAGG - Intronic
1097117840 12:56711240-56711262 TTCCAAGAAAAACTCAGTTTGGG - Intergenic
1098656800 12:73041490-73041512 TTCCTAGAAAAAGTCAGTGTGGG + Intergenic
1100299967 12:93297754-93297776 TTCCTAGAAAAAGACAGTGATGG + Intergenic
1101971279 12:109314597-109314619 TGTCCAGAAACACTCAGCCAGGG - Intergenic
1103150813 12:118637001-118637023 TTCCCAGAAAAAGCCAGAGAGGG - Intergenic
1108756152 13:53504762-53504784 GGCCCAGAAAATATCAATGAAGG - Intergenic
1110058649 13:71012375-71012397 TGCTCATACAAACTCAGTGTTGG - Intergenic
1110543885 13:76735459-76735481 TGCCCAGAACATCACAGTGATGG + Intergenic
1110754844 13:79160735-79160757 TATCCAGGAAAACTGAGTGATGG - Intergenic
1111582175 13:90236636-90236658 TGGCCAGTGAAATTCAGTGAAGG + Intergenic
1112973944 13:105293998-105294020 TGACCAGAAAATTTAAGTGAAGG - Intergenic
1112983345 13:105415107-105415129 AGCCAAGCAAAAATCAGTGAGGG + Intergenic
1113124911 13:106966712-106966734 TTCCCAGAAGGAATCAGTGAGGG + Intergenic
1113783761 13:112991165-112991187 TTCGCAGAAAGCCTCAGTGAGGG - Intronic
1117971658 14:61256944-61256966 GGCCAAGATAAACACAGTGAAGG - Intronic
1119460023 14:74793920-74793942 TGCCCAGAGAACCTCAGAGAAGG - Intronic
1120875328 14:89370243-89370265 GGCCCTAAATAACTCAGTGAAGG + Intronic
1121503739 14:94460679-94460701 TGCCCATGAAAACACAGAGAGGG - Intergenic
1121565753 14:94908165-94908187 TGCCCAGAGAAACCCACTGGAGG - Intergenic
1122327565 14:100891611-100891633 TGCCCAGAATAACCCTGGGAAGG + Intergenic
1122348543 14:101074878-101074900 GGCTCAGACAAACTCAGGGAAGG - Intergenic
1122678218 14:103435146-103435168 TGCCCAAAATAACCCAGTGGTGG - Intronic
1127724304 15:61733200-61733222 AGTCCAGACAAATTCAGTGAAGG + Intergenic
1128537359 15:68501161-68501183 TGCCCTTAAAAATACAGTGAAGG - Intergenic
1129446939 15:75625402-75625424 TGCCTAGAAAAAGGCAGTGCGGG - Exonic
1130705435 15:86228797-86228819 TGCCCAGAAAGAGACAGAGACGG - Intronic
1130932119 15:88437001-88437023 TCCCCAGACAACCTCAGTGAAGG + Intergenic
1132244094 15:100280983-100281005 TGCCCAGATCTGCTCAGTGATGG - Intronic
1132275693 15:100561645-100561667 TAACCAGAAAAACTCAGAAATGG + Intronic
1136284863 16:29234724-29234746 TGCCCAGAAAAACAGAGACAAGG - Intergenic
1139656646 16:68391477-68391499 TGCTCAGAGAGACTAAGTGAAGG - Intronic
1139662727 16:68432661-68432683 TGACCAGCAAATCTCAGTGGGGG + Intronic
1141256800 16:82409816-82409838 TGTCCAGCAAGACTCAGTAAGGG - Intergenic
1144725950 17:17502894-17502916 TGCCCAGAACAACTCTGTAGGGG + Intergenic
1148136986 17:45299787-45299809 TGCCCTCAAAAACTCAGTCTCGG + Intronic
1148374417 17:47129491-47129513 TGCACTGAAAAAATCAGAGAAGG - Exonic
1149331835 17:55590735-55590757 AGTCCAGAAAAACTGAGTGTTGG + Intergenic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1152383970 17:79957803-79957825 TTCACAGCAAAACTGAGTGAAGG - Intronic
1153523171 18:5970886-5970908 TGCACAGAGAAGCCCAGTGATGG - Intronic
1153771710 18:8422103-8422125 TGCCCAGAAAAACTGAAAGTAGG + Intergenic
1155274879 18:24177101-24177123 TGGCCAGAGAAACTGAGTAAAGG - Intronic
1156455976 18:37294383-37294405 TGCCCAGAGTAACTCAGAGCTGG - Intronic
1158076098 18:53531571-53531593 TGCCAAGGAGAACTCAGGGAGGG - Exonic
1158940033 18:62399343-62399365 TGGCCAGAAAGCGTCAGTGAGGG - Intergenic
1160144334 18:76351080-76351102 AGCCCAGTAAAAGCCAGTGACGG + Intergenic
1162708244 19:12571987-12572009 AGTCCAGAAAGAGTCAGTGAAGG - Intronic
1163441842 19:17325976-17325998 TCCCCAGAGAACCTCAGTGTGGG - Intronic
1163645573 19:18487188-18487210 TCCCCATAAAAACCCATTGAGGG + Intronic
1165098510 19:33424124-33424146 TGCCCTGAAAGCCCCAGTGAGGG - Intronic
925293457 2:2763208-2763230 CTCCCAGAAAAGCTCAGTTATGG + Intergenic
925512328 2:4641686-4641708 TGCTCAGAAACACTGGGTGATGG + Intergenic
925633685 2:5921534-5921556 TGCCTAGAACCACTCAGTAATGG - Intergenic
926468656 2:13224289-13224311 GTCCCAGAAAAACTTTGTGATGG - Intergenic
927315671 2:21678142-21678164 TCCCCAGAAAACCCCAGGGAAGG + Intergenic
929565370 2:42980467-42980489 TGCCTACAGAAACACAGTGATGG + Intergenic
929792035 2:45030459-45030481 TTTCCAGGAAAACTCAGAGAAGG + Intergenic
930453854 2:51580517-51580539 TGCCTAAAAACACACAGTGATGG + Intergenic
931601933 2:64012931-64012953 TGCCCTGAAAAAGTCAAAGAAGG + Intronic
932048061 2:68369952-68369974 TGCCTATACAAACTCACTGAAGG - Intronic
932300567 2:70664029-70664051 TGCCTAGAAAAACTCTGAGCTGG - Intronic
933902069 2:86857262-86857284 TGCCCTGATATACCCAGTGAGGG - Intronic
934541353 2:95177857-95177879 TGCCCGGCAAAATTCAGGGAGGG + Intronic
935093926 2:99925684-99925706 TGCCCAGACAGCCTCAGTGAGGG - Intronic
935738139 2:106122864-106122886 TCCCCAGACAAAATCAGTCATGG + Intronic
935778475 2:106492001-106492023 TGCCCTGATATACCCAGTGAGGG + Intergenic
936084543 2:109457767-109457789 TGCCCAGAAAAACTCAGTGATGG + Intronic
937999941 2:127725190-127725212 TGCCCATAAAAACACAGTAATGG - Exonic
938840170 2:135153171-135153193 TGATCAGAATAACACAGTGATGG - Intronic
941376929 2:164742766-164742788 TGTCTAGAAAAACTCATTCAAGG - Intronic
943939315 2:193970737-193970759 TACCAAGAAATTCTCAGTGAAGG - Intergenic
946793154 2:223321675-223321697 TGCTCCGCAAAATTCAGTGATGG + Intergenic
948633558 2:239318228-239318250 TGCCCGGAAGCTCTCAGTGAAGG - Intronic
948760452 2:240187141-240187163 TTCCCTGCAAAACTCTGTGAGGG - Intergenic
1169920892 20:10733247-10733269 TGCCCAGTCAAAATCAGTGGAGG - Intergenic
1172126941 20:32630120-32630142 TCCCCAGAAAGACTCTGTGAGGG + Intergenic
1173957693 20:47047184-47047206 GGCCCAGAATTACTCACTGAGGG - Intronic
1174815487 20:53683638-53683660 TCCCCAGAACAGCTTAGTGAAGG + Intergenic
1175613681 20:60373946-60373968 TTCCCATGAAAACACAGTGAAGG - Intergenic
1177979482 21:27893037-27893059 TGCCCAAAGAAAAACAGTGATGG + Intergenic
1179524137 21:41964822-41964844 TGCCCAGAATAGGTGAGTGACGG + Intergenic
1181331711 22:22098019-22098041 TCCCCAGCAGAGCTCAGTGATGG + Intergenic
1185167851 22:49272662-49272684 TGCCCAGAAAAGCCCAGAGCTGG - Intergenic
949164572 3:923249-923271 TGCCCTGATAAACTCTTTGAGGG + Intergenic
949348275 3:3097687-3097709 TGTCCAGCAAAACTCACTGGTGG + Intronic
953231000 3:41065051-41065073 TACCCAGACACACCCAGTGATGG + Intergenic
954521840 3:51234803-51234825 TGCCCAGAAAAGCCCTATGAAGG - Intronic
955713914 3:61808748-61808770 TGGCCAGAGAAGCTCAGTGAAGG + Intronic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
964033760 3:152170221-152170243 TGGATAGAAAAACTCAGGGAGGG - Intergenic
964879040 3:161403360-161403382 TGCCCAGAAAATCTGAGTTTTGG + Intergenic
966686464 3:182701134-182701156 TGCAAATTAAAACTCAGTGAGGG - Intergenic
966900853 3:184483195-184483217 TGCCCAGAACCACACAGTGGTGG - Intronic
966978852 3:185111027-185111049 TGCCAAGAACAGCTCAGTCAGGG - Intronic
967917321 3:194588377-194588399 AGCCCAGCCACACTCAGTGACGG + Exonic
972740676 4:41883265-41883287 GGCCCAGATAAACTCGGCGATGG - Intergenic
974292259 4:59948057-59948079 TGAACAGAAAAACTCAGTCCTGG + Intergenic
974441590 4:61925348-61925370 TACCCAGAAAAACTGAGTAGAGG - Intronic
977442754 4:97090432-97090454 TCACCTGAAATACTCAGTGATGG - Intergenic
977501230 4:97840778-97840800 TGCCTAGAAAAAGTGACTGATGG - Exonic
978068484 4:104436245-104436267 TTCCCATAAAAAGTCAGTAATGG - Intergenic
979471789 4:121107555-121107577 TGCCCAGAAGAAACGAGTGATGG + Intergenic
979574278 4:122268537-122268559 TAGCCAGAAAAACTCAGTGGAGG - Intronic
979593653 4:122508808-122508830 TGCCCAAGAAGACTAAGTGAAGG + Intergenic
979691639 4:123565209-123565231 TGCCCAGAAATTCTAAGTCAGGG + Intergenic
980254309 4:130357781-130357803 TAACCAGAAAAACACAGTGGAGG + Intergenic
981694275 4:147543912-147543934 TGCCCAGCAAAAGTCACTGTGGG - Exonic
982100089 4:151959063-151959085 TGCCCAAAAAAACTCCCTTAGGG - Intergenic
984170054 4:176348574-176348596 AGCCCAGAAAAAGTGAGTAAAGG - Intergenic
984202509 4:176743050-176743072 AGGCCAGAAATACTCAGTAAGGG + Intronic
985593094 5:775422-775444 TGCGGAGAAAGACTCTGTGATGG + Intergenic
987194297 5:15509956-15509978 TACCCAGGAAAATTCAGAGATGG - Intronic
989015519 5:36927369-36927391 TGCTCTGAAAAAGTCATTGAAGG + Intronic
989373119 5:40730796-40730818 TGCTCAGAAAAACTTAGAAATGG + Intronic
990364418 5:55055208-55055230 TGACCCCCAAAACTCAGTGAAGG + Intergenic
990614585 5:57494618-57494640 GTCCCAGAAAGACTCAGTAATGG + Intergenic
992450157 5:76869108-76869130 TGCTCAGAAATCCTCACTGATGG - Intronic
994844749 5:104974326-104974348 TTACCAGAATAATTCAGTGATGG - Intergenic
995313866 5:110744762-110744784 TACTTAGAAAAACTCATTGACGG - Intronic
996766933 5:127043974-127043996 TGCACAGAAGACCTCAGTGGTGG - Exonic
998059467 5:139108411-139108433 TGCCCAGAAATATCCAATGATGG + Intronic
998071754 5:139203311-139203333 TTCCCAGAAAAGCTAAGTCAAGG + Intronic
998484658 5:142491134-142491156 CCCACAGAAAAATTCAGTGAAGG + Intergenic
999246680 5:150158773-150158795 CGCCCAGGAAGACACAGTGATGG - Intergenic
1001726462 5:173906343-173906365 TGGACAGAAAAGATCAGTGAGGG + Intronic
1001912513 5:175532725-175532747 TCCTCACAATAACTCAGTGAGGG - Intergenic
1004759947 6:18655717-18655739 TACCAAACAAAACTCAGTGATGG - Intergenic
1005704788 6:28440732-28440754 TGCCCAGAAAAATTCATTTCTGG + Intronic
1006521209 6:34572277-34572299 AGCCCAGAAAAGCTCGCTGATGG - Intergenic
1007244723 6:40452625-40452647 AGTCCAGAAAAACTTAGTGATGG + Intronic
1007915021 6:45553256-45553278 TCCCCAGAAGAACTTAGAGATGG - Intronic
1010395375 6:75386157-75386179 TGACCACAAAAACTCAGTAGAGG - Intronic
1013202466 6:107912715-107912737 TGACCAGAAAAACTCAATTCTGG - Exonic
1013616258 6:111845925-111845947 TATCCAGAAAAACTCCATGATGG - Intronic
1013630701 6:111983376-111983398 TGGCCAGAAGACCTCAGGGAAGG + Intergenic
1014178582 6:118357780-118357802 TGCCCAATTAAAATCAGTGAAGG + Intergenic
1014467637 6:121775964-121775986 TTTCCAGGAAAGCTCAGTGAAGG + Intergenic
1016646365 6:146413271-146413293 TGTCCAGGAAAAATCAGTAAGGG - Intronic
1020509313 7:9032995-9033017 TGCCAAGAAAAACTCGGTCATGG - Intergenic
1021238866 7:18176241-18176263 AGACCAGAAAAACACAGGGAAGG - Intronic
1021403202 7:20233882-20233904 TGCCAAGAAAATCTACGTGATGG + Intergenic
1023226936 7:37979894-37979916 TGACCATAAGAACTCAGAGAAGG - Intronic
1024360696 7:48464369-48464391 TGGCCAGAAACACACAATGATGG - Intronic
1024886197 7:54145695-54145717 TGACTGGAAAAACGCAGTGAGGG + Intergenic
1025114303 7:56244753-56244775 TCTCCAGAAAACCTCAGAGATGG + Intergenic
1026658071 7:72274823-72274845 CACCCAGCCAAACTCAGTGAAGG - Intronic
1028779677 7:94722293-94722315 TGCCAAGAACAGCTCAGTCAGGG + Intergenic
1029094394 7:98073534-98073556 TGAACAAAAAAACCCAGTGAAGG + Intergenic
1029298657 7:99561072-99561094 AGCAAAGAAAAACTAAGTGAAGG - Intronic
1029607137 7:101605945-101605967 TTGCCAGAAAAACAGAGTGATGG + Intergenic
1029661201 7:101963264-101963286 TGAGCAGAAAACATCAGTGAGGG - Intronic
1032262400 7:130347746-130347768 TCCCTAGAAAAACACAGGGAGGG - Exonic
1033040781 7:137916093-137916115 TCCCCAAAAAAGCTCAGTGAAGG + Intronic
1033249710 7:139748101-139748123 TTCTCTAAAAAACTCAGTGAGGG + Intronic
1033511915 7:142067572-142067594 TGCCAAGAACACCTAAGTGATGG - Intronic
1036145068 8:6247487-6247509 TGCCCTGGAGAACTCAGTGGAGG - Intergenic
1036518038 8:9463694-9463716 TGCCCAGGAAATCACATTGAGGG + Intergenic
1037244155 8:16812578-16812600 GGATGAGAAAAACTCAGTGACGG - Intergenic
1037430257 8:18804803-18804825 ACCCCAGAAAATCTCAGTAATGG - Exonic
1037927118 8:22852159-22852181 TGTCCATTAAATCTCAGTGATGG - Intronic
1038908140 8:31930765-31930787 TGCCCTAAAAAAGTCAGTGGTGG - Intronic
1041663090 8:60417721-60417743 TACCCACACAAACTCAATGAAGG + Intergenic
1041890979 8:62868683-62868705 TATCCTGAAAAACTTAGTGAGGG + Intronic
1043190241 8:77212192-77212214 TGCTCAGGAAATCTCAGTGGAGG - Intergenic
1043550356 8:81364629-81364651 AGCCAAGAAAAACTCAGATAGGG + Intergenic
1044941957 8:97352646-97352668 TGCCTAGCAACACTCAGTGAGGG - Intergenic
1045226658 8:100253714-100253736 TCCTCAGAACAACTCTGTGAAGG - Intronic
1045835960 8:106521863-106521885 GTCCCAGAGAATCTCAGTGAAGG + Intronic
1046782552 8:118231099-118231121 TCCCCATAACAACTCAGAGAAGG - Intronic
1047806096 8:128361586-128361608 TGCCCAGAGGCACTCAGTGTTGG + Intergenic
1048301835 8:133256951-133256973 TACCCAGAAAAAGGCAGTGTGGG + Intronic
1048918078 8:139203296-139203318 TGCCCAGACCAGCTCAGTCAGGG + Intergenic
1051527340 9:18060869-18060891 TTACCAGAAAATCTCAGTAATGG + Intergenic
1052662190 9:31447903-31447925 TGGCAAGAAAATTTCAGTGAGGG - Intergenic
1055597652 9:77881748-77881770 TACCCATAAAAACTCAATGAAGG - Intronic
1055904507 9:81277183-81277205 TACCCAGAAAATCTCAGTAGAGG - Intergenic
1056938063 9:90933047-90933069 TGGCCAGAAAAATGCAGAGAGGG + Intergenic
1057388044 9:94621728-94621750 TGCCCAGAAAGAACCAGTGTTGG + Intronic
1058761538 9:108138444-108138466 TGCCCATAAATACTGAGTGTTGG - Intergenic
1058794987 9:108489157-108489179 AACTCAGAAAAACTCAGTGTGGG - Intergenic
1059008922 9:110435321-110435343 TGCCCAGAGGAACTCAGTAAAGG - Exonic
1060988676 9:127836045-127836067 TTACCAGAAAAACCCAGTCAGGG + Intronic
1061744635 9:132730602-132730624 TGCCCAGAACTGCTCAGTCAGGG + Intronic
1062715705 9:138009108-138009130 TGCAAAGAAAAACACCGTGATGG + Intronic
1187417286 X:19104207-19104229 ACCACAGAGAAACTCAGTGAGGG + Intronic
1188208958 X:27395250-27395272 TGCCCATAAAAGCTCAGTGGTGG + Intergenic
1188515581 X:30981998-30982020 TAACCAGAAAAACTCAGGGAAGG + Intergenic
1189094887 X:38127648-38127670 AGATAAGAAAAACTCAGTGAAGG - Exonic
1190724718 X:53181389-53181411 TGCCAGGGGAAACTCAGTGAGGG - Intergenic
1191901852 X:66049512-66049534 TGCATAGAAAAATTCTGTGAAGG + Intergenic
1192638883 X:72845194-72845216 TTGCCAGAAACACTCACTGAGGG - Exonic
1192642829 X:72875614-72875636 TTGCCAGAAACACTCACTGAGGG + Exonic
1196457694 X:115901686-115901708 TCCCCACAAAAATTCTGTGACGG + Intergenic
1198807816 X:140507175-140507197 GGCCCAGAAAAGCCCAGAGAGGG - Intergenic
1199266638 X:145835567-145835589 TATCCAGTGAAACTCAGTGATGG - Intergenic
1199522080 X:148747376-148747398 TGCCCATTAAAACTCTATGAAGG + Intronic
1200702280 Y:6412431-6412453 TGCCTACAATAACTCAATGAGGG + Intergenic
1201031831 Y:9752267-9752289 TGCCTACAATAACTCAATGAGGG - Intergenic