ID: 936084649

View in Genome Browser
Species Human (GRCh38)
Location 2:109458726-109458748
Sequence GAGCAATCACAGGCATCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936084649_936084653 -1 Left 936084649 2:109458726-109458748 CCACAGGATGCCTGTGATTGCTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 936084653 2:109458748-109458770 CTTAAGGCCTTCAGCTGATTGGG 0: 1
1: 12
2: 30
3: 53
4: 159
936084649_936084654 4 Left 936084649 2:109458726-109458748 CCACAGGATGCCTGTGATTGCTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 936084654 2:109458753-109458775 GGCCTTCAGCTGATTGGGCGAGG 0: 2
1: 5
2: 72
3: 380
4: 821
936084649_936084652 -2 Left 936084649 2:109458726-109458748 CCACAGGATGCCTGTGATTGCTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 936084652 2:109458747-109458769 TCTTAAGGCCTTCAGCTGATTGG 0: 12
1: 101
2: 261
3: 583
4: 864
936084649_936084656 23 Left 936084649 2:109458726-109458748 CCACAGGATGCCTGTGATTGCTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 936084656 2:109458772-109458794 GAGGCCCACCCACATTATCAAGG 0: 4
1: 33
2: 173
3: 452
4: 807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936084649 Original CRISPR GAGCAATCACAGGCATCCTG TGG (reversed) Intronic