ID: 936087967

View in Genome Browser
Species Human (GRCh38)
Location 2:109482400-109482422
Sequence CTTTGGCAACAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936087967_936087971 20 Left 936087967 2:109482400-109482422 CCCAGCTCCATCTGTTGCCAAAG 0: 1
1: 0
2: 2
3: 23
4: 311
Right 936087971 2:109482443-109482465 TCCCGCAGAACACCGTGCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936087967 Original CRISPR CTTTGGCAACAGATGGAGCT GGG (reversed) Intronic
902553665 1:17234081-17234103 CTTTGGAATCAGATGGACTTGGG + Intronic
902873602 1:19328347-19328369 GCTTGGAGACAGATGGAGCTTGG + Intronic
906519206 1:46457332-46457354 CTTTGGAAGCAGACAGAGCTGGG + Intergenic
906848891 1:49226089-49226111 CTTTGTTAACAGATGGACCTGGG - Intronic
908654334 1:66371986-66372008 CTTTGGAATCAGATGAAGCTGGG + Intronic
908844776 1:68313478-68313500 CTTTAGCATCAGATAGACCTGGG - Intergenic
909473218 1:76053072-76053094 CTCTGGCAGCAGCAGGAGCTGGG + Intergenic
911793923 1:102053507-102053529 CCTTGGCCAGAGCTGGAGCTGGG + Intergenic
914684438 1:149965805-149965827 CTTTGGCAACTACTGGAGATGGG - Exonic
915254751 1:154618679-154618701 GTTATTCAACAGATGGAGCTGGG + Intronic
916059353 1:161088188-161088210 CTTTGGCTGGAGATGGAGGTAGG + Intronic
916628789 1:166589288-166589310 ATTTGACAACAGCAGGAGCTTGG - Intergenic
918651171 1:186965273-186965295 CTTTGGAGACAAATAGAGCTGGG - Intronic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
922689389 1:227676056-227676078 CTTTGACAAAAGTTGGTGCTTGG + Intronic
923378428 1:233390171-233390193 TTCTGACACCAGATGGAGCTTGG - Intergenic
923446838 1:234079229-234079251 CCTTGTCAACAAATGGTGCTGGG + Intronic
1067429489 10:46233752-46233774 CTTTGGTGACAGATGAAGTTGGG + Intergenic
1067747686 10:48948517-48948539 CCTTAGCAACAGGTAGAGCTGGG - Intronic
1069407522 10:68117993-68118015 CTTTGGCATTAGATAGAACTGGG - Intronic
1069751590 10:70748582-70748604 AGTGGGCAACAGTTGGAGCTGGG - Intronic
1070338131 10:75472946-75472968 CTTTGGCATGAGAAGGAGATTGG + Intronic
1070480235 10:76875178-76875200 CTTTGGCAAAAGCTGGTGCCTGG - Intronic
1070841232 10:79489374-79489396 CTCTGGGAACAGATTGAGCCAGG - Intergenic
1071355831 10:84793237-84793259 TCTTTGCAAAAGATGGAGCTGGG - Intergenic
1071599499 10:86951199-86951221 CCTTGGGACCAGAGGGAGCTGGG + Intronic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1073638427 10:105223138-105223160 TTATGGCAACAAATGGAACTCGG - Exonic
1074139725 10:110661336-110661358 CACTGGCAACTGCTGGAGCTGGG - Intronic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075947198 10:126444929-126444951 CTTTTTCAACAAATGGTGCTGGG + Intronic
1076476399 10:130756702-130756724 TTTTTGCAACAAATGGAGATGGG + Intergenic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1078133647 11:8634637-8634659 CTTAGGCAACAGCTGGTGCCAGG + Intronic
1078291439 11:10014220-10014242 TTTTGCCTATAGATGGAGCTAGG + Intronic
1078404960 11:11062415-11062437 CTTTTCCAACAGGTGGACCTTGG + Intergenic
1079729765 11:23925370-23925392 CTTTGAGAACAGAGGGAGTTTGG - Intergenic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1081526528 11:43931519-43931541 CTTTGGCAGCAGATTGACCTGGG + Intronic
1082068874 11:47922599-47922621 CCTGGGCAACAGAGGGAGATAGG - Intergenic
1083086237 11:60148920-60148942 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1084200400 11:67553454-67553476 CTTGGGCAACAGAGGCAGCTTGG + Intergenic
1084680744 11:70664812-70664834 CTTTGGCATCACACGGAGCGTGG + Intronic
1085775616 11:79363676-79363698 CTTTTGGAAAAGATTGAGCTGGG + Intronic
1086090703 11:83002075-83002097 CTTTGGGGTCAGATGGATCTAGG - Intronic
1086298070 11:85394024-85394046 TTTGGGGAACAGGTGGAGCTTGG - Intronic
1086821116 11:91437430-91437452 CTTTGGCAGCGGCTGGACCTTGG - Intergenic
1087751370 11:102011086-102011108 CTTTGGCAAAAGAAGGAGAGTGG - Intergenic
1088673225 11:112164593-112164615 CTTTGACACCATATTGAGCTTGG - Intronic
1089772949 11:120816355-120816377 CTTAGGGGGCAGATGGAGCTTGG + Intronic
1090770711 11:129917387-129917409 CTTTGGCATCAGATGGGGTCTGG - Intronic
1091437153 12:481674-481696 CTTTGCCAACAGCTGTGGCTGGG + Intronic
1091534724 12:1395045-1395067 CTTTGAGAACAGATACAGCTGGG + Intronic
1091934164 12:4422324-4422346 TTCTGGCAAAAGATGGAGCAGGG + Intergenic
1092783780 12:12010045-12010067 CTTTGGCCATAGATGGACCTCGG + Intergenic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1094344677 12:29454054-29454076 GTTTGGGAATAGATGGAGATCGG - Intronic
1094524874 12:31224941-31224963 ATCTGGCAGCAGAGGGAGCTGGG - Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1096407522 12:51354662-51354684 ATTTGGCACCAGATAGAGGTGGG - Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1096733039 12:53629833-53629855 CTTTTCCAACAAATGGTGCTGGG - Intergenic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097492355 12:60285596-60285618 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1098467212 12:70801196-70801218 AGTTGGAAACAGATGGAGTTGGG + Intronic
1099777019 12:87146845-87146867 CCTTGTCAACAAATGGTGCTGGG - Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100218555 12:92479292-92479314 CTTTGCAAACAGATGGAATTTGG - Intergenic
1101735148 12:107457863-107457885 CTTTGGCAACAGAAAGAAATGGG + Intronic
1102359233 12:112269354-112269376 CTTTGGCAACAGGCAGACCTGGG - Intronic
1102715010 12:114962994-114963016 CTTTGGAGTCAGATGGACCTGGG - Intergenic
1103220146 12:119237415-119237437 CTTTGGCATCAGGTAGAGCCTGG - Intergenic
1103478996 12:121238853-121238875 TTCTGGCACCAGATGGGGCTTGG - Exonic
1104919334 12:132282505-132282527 TTTTGGGAACAGCTGGATCTAGG + Intronic
1105711474 13:23013442-23013464 CTTTGGCAGCAGTAGTAGCTAGG + Intergenic
1106175708 13:27329417-27329439 CTTTGGAATCAGATGGATCTGGG + Intergenic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1107272157 13:38632526-38632548 ATTTGGAATCAGATGGACCTTGG - Intergenic
1108497622 13:51040864-51040886 CTTTGGAATCAGACGGACCTGGG - Intergenic
1109125775 13:58515238-58515260 CCTTGTCAACAAATGGTGCTGGG + Intergenic
1109478000 13:62910201-62910223 CATTGTCAACAAATGGTGCTGGG + Intergenic
1113311544 13:109138119-109138141 CTTTGGAATCAGAGGGATCTGGG - Intronic
1114317284 14:21520975-21520997 CTTTGGCAGGAGATGTAGGTGGG + Intergenic
1114547459 14:23513212-23513234 GGTTGGCAGCCGATGGAGCTGGG - Intergenic
1114652071 14:24291545-24291567 CTTTGGCAACAGGTGAAGTTTGG - Exonic
1115918154 14:38341159-38341181 ATTAGGCAAAAGATAGAGCTAGG - Intergenic
1117003489 14:51395092-51395114 CTTTGGGAACAGTAGGAGGTGGG - Intergenic
1117646266 14:57856359-57856381 CTTTGGCAACAGAAAGACCTAGG - Intronic
1117755125 14:58966908-58966930 CTTTGGGAACAAAAGGAGATAGG + Intergenic
1119253155 14:73174869-73174891 CTTTGGCAAAAGAGCGAGCTAGG - Intronic
1120356059 14:83435536-83435558 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1121177331 14:91900614-91900636 CTTTGGGAGCAGACAGAGCTGGG + Intronic
1121927239 14:97939000-97939022 CTATGTCAACACTTGGAGCTAGG + Intronic
1124194376 15:27608286-27608308 CATTGGCAACAAATTCAGCTGGG - Intergenic
1124611888 15:31215077-31215099 CTCTGGCTACTGCTGGAGCTGGG - Intergenic
1125904536 15:43378878-43378900 CTTTGGAGCCAGATAGAGCTGGG - Intronic
1126611766 15:50537196-50537218 CTTTTTCAACAAATGGTGCTAGG + Intronic
1127607161 15:60597975-60597997 CTTTGGCATTAGATGAAGTTGGG + Intronic
1128353266 15:66906184-66906206 CTTTGGAATCAGAGAGAGCTGGG + Intergenic
1129179551 15:73865326-73865348 ATTTGCAAACAGATGGAGTTGGG + Intergenic
1130043501 15:80426261-80426283 CTTTGGTCACAGAAGGAGCTAGG - Intronic
1130435591 15:83896069-83896091 CTTTGGCAATAGATGGCTCTGGG + Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1132788602 16:1672213-1672235 CCTGGGCAACAGATGGCACTTGG + Intronic
1133191399 16:4136187-4136209 CTTTGGCAGCAGATACGGCTGGG - Intergenic
1133880096 16:9773548-9773570 TCTTGGGAACAGATGGAGCCTGG + Intronic
1134131824 16:11655482-11655504 CTTTGGGGTCAGATGCAGCTGGG + Intergenic
1134327811 16:13223065-13223087 CTTTGACAGCAGATGGATCTGGG - Intronic
1135657465 16:24263595-24263617 CTTTGGGAGCAGGTGGACCTGGG + Intronic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137767033 16:50985600-50985622 CAGTGGCAGCAGGTGGAGCTGGG + Intergenic
1138597265 16:58035686-58035708 CTCTGGGGACAGGTGGAGCTAGG - Intronic
1139012740 16:62652905-62652927 CTCTGGGAACAGATGGCTCTTGG - Intergenic
1140645967 16:77030050-77030072 CATTGGCAACAGCTGGATTTTGG + Intergenic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1143278028 17:5728796-5728818 CTTATGCAACAAATGGTGCTGGG + Intergenic
1143869148 17:9945458-9945480 CTTTGGCATCAGACAGACCTGGG - Intronic
1144412936 17:15019105-15019127 CTTTGGCTACAGAAGAAGATTGG + Intergenic
1144937875 17:18914690-18914712 CTTTGGCAAAAGAGGGTGCATGG - Intronic
1146261668 17:31426018-31426040 CTTTTGCCACAGATGGTCCTCGG - Intronic
1147436004 17:40415829-40415851 CGTTGGCAACTGTTGGATCTAGG + Intronic
1149392567 17:56206748-56206770 CTTTGGCAAGAGATGGGGATGGG + Intronic
1149844554 17:59998137-59998159 CTTTGACAATAGATGGAACCAGG - Intergenic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1154263549 18:12859524-12859546 CTTTGGCATCTGAAGGACCTTGG - Intronic
1155242827 18:23879593-23879615 ATTTGGTGACAAATGGAGCTAGG + Intronic
1156984757 18:43336825-43336847 CTTTTTCAACAAATGGTGCTAGG - Intergenic
1157480026 18:48047963-48047985 CTTTGGCATCAAACGCAGCTGGG - Intronic
1160286946 18:77551885-77551907 CCTGGGCAACAGAGGGAGCCCGG - Intergenic
1160369851 18:78363035-78363057 CTTTGCTAAAAGATGGAGTTGGG - Intergenic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161944089 19:7423748-7423770 CTTTGGCATCAGGTGGAACACGG - Intronic
1164599638 19:29552296-29552318 CTTTGGCAAAAGAAGGACCTAGG - Intronic
1165703505 19:37957025-37957047 TTTTTTCAACAAATGGAGCTGGG - Intronic
1166711570 19:44941025-44941047 CTCTGGCTTCAGATGGACCTGGG - Intergenic
1166926296 19:46271057-46271079 CTTTGGCAACAAATGGAAACTGG + Intergenic
1167508338 19:49882752-49882774 CTTTGCCTGCAGGTGGAGCTGGG + Exonic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925888861 2:8417214-8417236 CTTTGGCAACAGATGTATTAGGG - Intergenic
926089013 2:10038008-10038030 CTTTGGCAAAAGTTGCAGATTGG + Intergenic
926130303 2:10299074-10299096 CTTTTTCAACAAATGGTGCTGGG + Intergenic
926774368 2:16407425-16407447 GTTAGGCAACAGGTTGAGCTGGG + Intergenic
927701293 2:25270536-25270558 CCTGGGGAACAGCTGGAGCTGGG + Intronic
929057657 2:37892249-37892271 CTTGGGCAACCGATGGTGCCAGG - Intergenic
929659836 2:43773054-43773076 CTTTGGCGTGAGATGGACCTAGG - Intergenic
929721372 2:44372061-44372083 CTTTAACAACCTATGGAGCTAGG - Intronic
930158955 2:48133332-48133354 CATTGGCAACAGATATAGCAAGG + Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
932997471 2:76872896-76872918 ATTTGGCAAGAGAGGGAGCAAGG - Intronic
933413866 2:81959488-81959510 CTTTGCCAATAGATGGTGATGGG + Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
937249952 2:120517349-120517371 GTTTGGAACTAGATGGAGCTGGG - Intergenic
940333126 2:152497050-152497072 CGTTCTCAACAGATAGAGCTAGG + Intronic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
946012101 2:216573600-216573622 CTTTGGCATCAGCTAGACCTGGG - Intronic
946237612 2:218333679-218333701 CTCTGGCAACAGAAAGATCTGGG - Intronic
946498964 2:220225398-220225420 CTTTGGAATCAGATAGAACTTGG + Intergenic
946618998 2:221540828-221540850 CATAGGCAACAGAGGGAGATGGG + Intronic
947948102 2:234124001-234124023 TTCTGGCAACAGGTGCAGCTAGG - Intergenic
948065007 2:235071390-235071412 CTTTTTCAACAAATGGTGCTGGG + Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
1170551338 20:17480089-17480111 CTTTGGCGAGAGTTGGAGCGAGG - Intronic
1170720626 20:18874912-18874934 CTTTTTCAACAAATGGTGCTGGG - Intergenic
1170818940 20:19739646-19739668 CTTTGGAAGGAGCTGGAGCTGGG + Intergenic
1172281533 20:33711302-33711324 CCTTGACAAGAGATGGCGCTGGG + Intronic
1172938006 20:38634445-38634467 CGTTTGCAAGAGGTGGAGCTTGG + Intronic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1174009602 20:47439009-47439031 CCTAGGCAACAGAAAGAGCTGGG + Intergenic
1174311634 20:49660269-49660291 CTTTGGTAACAGGTGGAACAGGG - Intronic
1174696455 20:52564584-52564606 CTTTGGAACCAAATGGACCTGGG - Intergenic
1175301164 20:57943640-57943662 CTTTGGCCCCACATGAAGCTAGG + Intergenic
1176167207 20:63680545-63680567 ATTGGGCAGGAGATGGAGCTTGG + Intronic
1176264370 20:64201145-64201167 TTTTGGTAACAGATGGAGTGTGG + Intronic
1177813110 21:25945990-25946012 CTTTTTCAACAAATGGTGCTGGG + Intronic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
1182413410 22:30205684-30205706 CTTTGGCATCAGATGAGTCTTGG + Intergenic
1182510753 22:30818414-30818436 TTTTTGCAACAGATGGCACTGGG + Intronic
1183065699 22:35361275-35361297 CTTTGGCATCAGACGGAGCTGGG - Intergenic
1183420429 22:37708792-37708814 CTCTGGCCTCAGATGGACCTCGG - Intronic
1183617401 22:38954023-38954045 CTTTGCCACCAGAAGGAGTTGGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
950671044 3:14525571-14525593 CTCTGCCAACAGATGGGGATGGG + Exonic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
951463360 3:22975076-22975098 CTTTTTCAACAAATGGTGCTGGG + Intergenic
951636113 3:24778986-24779008 TTTTGGCAACAGGTGGTGTTTGG + Intergenic
951749793 3:26021853-26021875 TTTTGGGAACAGATGGGGTTTGG + Intergenic
952082428 3:29776277-29776299 CTTTGGAATCAGATGGACTTTGG + Intronic
952860408 3:37807941-37807963 GTTTGGCAAGAGGAGGAGCTTGG + Intronic
954006836 3:47597915-47597937 CTTTGGGAACAGATGTAGGCTGG + Intronic
954904869 3:54052357-54052379 CTTTGGCATCATATTGATCTGGG + Intergenic
956128611 3:66034313-66034335 CTTTGGAATCAGACAGAGCTGGG + Intronic
956944966 3:74210498-74210520 CTTGGGTAACAAATGAAGCTGGG - Intergenic
957859344 3:85924474-85924496 CTTTGGCCCCCGATGTAGCTGGG - Intronic
958771601 3:98432691-98432713 CTTTGGCAACTGATGTTCCTGGG + Intergenic
959824135 3:110772821-110772843 CTTTGCCAAGACCTGGAGCTAGG + Intergenic
960535501 3:118810400-118810422 CTTTGGAAACAAATAAAGCTGGG + Intergenic
961462839 3:127063628-127063650 CCTAGGCAACATAGGGAGCTTGG - Intergenic
961949265 3:130730830-130730852 CTTTGGCATCAGAAAGACCTGGG + Intronic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
964339945 3:155697803-155697825 CCTTGGTAACAGAGGGAGCCAGG + Intronic
964885630 3:161479168-161479190 CTTTGGCATCAGAAAGACCTGGG + Intergenic
965925007 3:173967404-173967426 CTTTTGAAATAGATGTAGCTAGG + Intronic
967342820 3:188419488-188419510 CTCTGGCATCAGATAGATCTGGG + Intronic
969238752 4:5886455-5886477 CTTTTCCAGCCGATGGAGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970237963 4:13977718-13977740 CTCTGCCAGCAGATGGACCTTGG - Intergenic
970320115 4:14867229-14867251 CTTTGATAACAGGTGAAGCTCGG - Intergenic
971011243 4:22438194-22438216 CTTAGACAACAGAAGGATCTGGG + Intronic
975170905 4:71230976-71230998 CTTTGGCAAAAGCTTGGGCTAGG + Intronic
975301269 4:72794032-72794054 CCTCTGCAACAGATGGTGCTGGG + Intergenic
975357207 4:73421781-73421803 CTTTTTCAACAAATGGTGCTAGG + Intergenic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976407894 4:84680137-84680159 CTTTGGCATCCGAAGGTGCTAGG + Intronic
976656418 4:87493224-87493246 ATTTGGCGACTGAAGGAGCTAGG - Intronic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
982450304 4:155544673-155544695 TTTTGTCTACAGATGGAGCGGGG - Intergenic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
983424072 4:167559744-167559766 CTTTTTCAACAAATGGTGCTGGG - Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
984214930 4:176899341-176899363 CTTGTGAAATAGATGGAGCTAGG + Intergenic
985178336 4:187227563-187227585 CTCTGCCAACAGATGGGGCGGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
986984006 5:13479908-13479930 CTGTGGCAACATATGTAGCTAGG - Intergenic
987133678 5:14881989-14882011 CTTTGCCAACTGATTGAGCCAGG - Intergenic
987157833 5:15108823-15108845 CTTTGGCAAACAATAGAGCTGGG - Intergenic
987905437 5:24069908-24069930 CTTTGGCAACAGACGCACCTAGG + Intronic
988706725 5:33733960-33733982 CTTTGACATCAGATGGGTCTGGG - Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
990434969 5:55780648-55780670 ATTTGGCAACAGTGGGAGCAAGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
992942872 5:81780087-81780109 CTTGAGCAACAGCAGGAGCTGGG - Intergenic
993914279 5:93723212-93723234 CTAAGGCAACAGATTAAGCTGGG + Intronic
994922929 5:106074387-106074409 CTTTTTCAACAAATGGTGCTGGG + Intergenic
995782351 5:115791457-115791479 CTTTGGAATCAGATAGAACTTGG + Intergenic
997737799 5:136227279-136227301 GTTTGTAAACAGATGGACCTGGG + Intronic
998344800 5:141452446-141452468 CCTTGTCAGCAGACGGAGCTAGG + Intronic
998607671 5:143651695-143651717 CTTTGGAATCAGGTAGAGCTGGG + Intergenic
998859765 5:146430836-146430858 ATTAGGCAACAGAGAGAGCTAGG + Intergenic
999639538 5:153658331-153658353 ACTTGGCAACAGATGGAGGCTGG - Intronic
999686512 5:154108046-154108068 CTTTGGCAGGAGATGGAACAGGG - Intronic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
999865479 5:155696090-155696112 CTTTGCCAGTAGATGGATCTGGG + Intergenic
1000250632 5:159491637-159491659 CTGTGGTATAAGATGGAGCTGGG - Intergenic
1000353015 5:160367272-160367294 CTTGGGCAGCAGAAGGATCTGGG + Intronic
1000404463 5:160872607-160872629 CTTTTTCAACAAATGGTGCTAGG - Intergenic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1007100223 6:39240852-39240874 CTCTGGCACCAGCTGGAGATGGG - Intergenic
1008033133 6:46719381-46719403 CACTGGCACCAGCTGGAGCTTGG + Intronic
1008547595 6:52597089-52597111 AGCTAGCAACAGATGGAGCTAGG - Intergenic
1008638917 6:53441331-53441353 CTTTGGCATCAGACTGAGATGGG - Intergenic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1010732423 6:79404981-79405003 CTCTCGCAACAGGTGGAGCCTGG + Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1014286795 6:119508382-119508404 CTTTAGCAACAGATGCACATCGG + Intergenic
1015361015 6:132339585-132339607 CTTAGCCAAAAGATGTAGCTCGG - Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016799466 6:148154172-148154194 TTTTGGAGTCAGATGGAGCTGGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017788942 6:157778751-157778773 CTTTTGCATCAGTTGGACCTGGG - Intronic
1018810490 6:167294847-167294869 CTTTGGTGACAGACGGTGCTGGG + Intronic
1020064789 7:5179263-5179285 CTTTGCAAACAAATGGTGCTGGG + Intergenic
1022671025 7:32456244-32456266 CTTTGGCAACATATGTATGTAGG + Intergenic
1022757476 7:33308985-33309007 CTTTGGAATCAGAGTGAGCTTGG + Intronic
1023807277 7:43881870-43881892 ATTTGGCAACAGATTGGACTGGG - Intronic
1024895936 7:54262245-54262267 CTTTTTCAATAAATGGAGCTGGG - Intergenic
1027540293 7:79456298-79456320 CTTTGTCAATAGAAGGTGCTAGG + Intergenic
1030336008 7:108327052-108327074 CTCTGGCAACAGCTGGTGTTAGG - Intronic
1032796810 7:135284146-135284168 AAGTGGCAACAGATGGAGGTGGG - Intergenic
1032844994 7:135744705-135744727 CTCTGCCAGCAGATGGACCTGGG + Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034460670 7:151196246-151196268 CGTGGGCAGCAGGTGGAGCTAGG + Intronic
1038065664 8:23961385-23961407 CTATGGCCACAGAATGAGCTGGG - Intergenic
1038533692 8:28338822-28338844 CTTTGTAAAATGATGGAGCTGGG + Intronic
1038727106 8:30091533-30091555 CTTTGGCAGCAAATGGAGCAAGG - Intergenic
1039204128 8:35130790-35130812 CTTTTTCAAAAAATGGAGCTGGG - Intergenic
1039622393 8:39010307-39010329 CTGTGGCAATAGAAAGAGCTTGG + Intronic
1039728071 8:40243197-40243219 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1046507354 8:115153126-115153148 CTTTGGAATCAGATAGAGTTTGG - Intergenic
1047011384 8:120676451-120676473 CTTTGTAATCAGATGGACCTAGG - Intronic
1047467837 8:125135642-125135664 CTTCAGCAACAAATGGTGCTAGG - Intronic
1047734935 8:127756967-127756989 CTCTGGAATCAGATCGAGCTGGG - Intergenic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1049720287 8:144112442-144112464 CTTTGGCAGCAGTGGGATCTGGG - Exonic
1050147781 9:2588129-2588151 CCTTTGCAACAAATGGTGCTGGG + Intergenic
1050499070 9:6275917-6275939 CTTTTTCAACAAATGGTGCTTGG + Intergenic
1050675494 9:8048056-8048078 CTTTTCCAACAAATGGTGCTGGG + Intergenic
1050696549 9:8285802-8285824 CATTGGCACCAAATGAAGCTGGG + Intergenic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1052955842 9:34252730-34252752 CTTGGTCCACAGACGGAGCTGGG - Exonic
1053137294 9:35659020-35659042 CGCTGGCAACTGCTGGAGCTGGG + Intronic
1053212085 9:36238963-36238985 CTTTTTCAACAAATGGTGCTGGG - Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1057203162 9:93154471-93154493 TTTTGGCAATAGAGGGCGCTGGG + Intergenic
1057214339 9:93219778-93219800 TGGTGGCAACAGGTGGAGCTGGG - Intronic
1059432224 9:114257169-114257191 CTGAGGCACCAGATGGGGCTGGG + Intronic
1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG + Intergenic
1060089296 9:120728897-120728919 CAATGGCAAAAGATGGAGCCTGG - Intergenic
1060271086 9:122142250-122142272 CTTTGGAATCAGATGTATCTGGG + Intergenic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1060501043 9:124155651-124155673 TCTTGTCAACAGATGGAACTGGG - Intergenic
1061458572 9:130717558-130717580 CTTTGGCTCCAGTGGGAGCTTGG - Intronic
1062220126 9:135410583-135410605 CTTAGGGAACAGCTGGAGTTGGG - Intergenic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1186431614 X:9510089-9510111 CTTTGGCAACATCTAGAGTTTGG + Intronic
1187475381 X:19606308-19606330 CTGTGGCATCAGATAGATCTGGG - Intronic
1189215518 X:39319767-39319789 CTTTGGCTCCAGATGGAGGGTGG + Intergenic
1190395123 X:49974636-49974658 CTTTGGAATCAGATAGAGATGGG - Intronic
1192430584 X:71108914-71108936 CTTTGGAACCAGCTGGATCTAGG - Intronic
1195018990 X:100807433-100807455 CTTTTTCAACAAATGGTGCTGGG - Intergenic
1195666872 X:107439805-107439827 CTTTGGCAACAGAGAGACCTGGG + Intergenic
1196618508 X:117795251-117795273 CTTTGGAGTCAGATGGACCTAGG - Intergenic
1196904722 X:120420008-120420030 CTTTGGCACCAGAGAGAACTGGG + Intergenic
1197265562 X:124366274-124366296 CTTTGTCAACAGGTGAATCTGGG + Intronic
1197723130 X:129758482-129758504 CTGTGGCAACTGCTGCAGCTGGG + Intronic
1198161501 X:134012978-134013000 GTTTGGCACCAAATGGAGATTGG - Intergenic
1198777215 X:140192720-140192742 CTTAGGCAACAGAAGGGACTGGG - Intergenic
1200965746 Y:9035861-9035883 CTTTGGCAAGTGTTGGAGTTTGG + Intergenic
1201849038 Y:18456749-18456771 CTTTGGCAAGTGTTGGAGTTTGG - Intergenic
1201884280 Y:18863626-18863648 CTTTGGCAAGTGTTGGAGTTTGG + Intergenic
1202334753 Y:23796305-23796327 CTTTGGCAAGTGTTGGAGTTTGG + Intergenic
1202350997 Y:23991450-23991472 CTTTGGCAAGTGTTGGAGTTTGG + Intergenic
1202519782 Y:25678669-25678691 CTTTGGCAAGTGTTGGAGTTTGG - Intergenic
1202536014 Y:25873754-25873776 CTTTGGCAAGTGTTGGAGTTTGG - Intergenic