ID: 936088216

View in Genome Browser
Species Human (GRCh38)
Location 2:109484039-109484061
Sequence CACCAAGGTGTGCCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 107}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936088205_936088216 13 Left 936088205 2:109484003-109484025 CCAGACAACCCCAGCCTCCTCAG 0: 1
1: 0
2: 6
3: 42
4: 463
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088209_936088216 3 Left 936088209 2:109484013-109484035 CCAGCCTCCTCAGTTGGCCCTAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088204_936088216 16 Left 936088204 2:109484000-109484022 CCACCAGACAACCCCAGCCTCCT 0: 1
1: 0
2: 2
3: 54
4: 503
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088203_936088216 23 Left 936088203 2:109483993-109484015 CCAGCGTCCACCAGACAACCCCA 0: 1
1: 0
2: 0
3: 18
4: 153
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088211_936088216 -1 Left 936088211 2:109484017-109484039 CCTCCTCAGTTGGCCCTAGAGGC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088207_936088216 5 Left 936088207 2:109484011-109484033 CCCCAGCCTCCTCAGTTGGCCCT 0: 1
1: 0
2: 2
3: 52
4: 524
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088212_936088216 -4 Left 936088212 2:109484020-109484042 CCTCAGTTGGCCCTAGAGGCACC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088208_936088216 4 Left 936088208 2:109484012-109484034 CCCAGCCTCCTCAGTTGGCCCTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107
936088202_936088216 24 Left 936088202 2:109483992-109484014 CCCAGCGTCCACCAGACAACCCC 0: 1
1: 1
2: 0
3: 7
4: 104
Right 936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936088216 Original CRISPR CACCAAGGTGTGCCATCCTC TGG Intronic
900471345 1:2856549-2856571 CTCCAAGGGGTGCCAGCCACCGG - Intergenic
902756194 1:18550741-18550763 CACAAAGGTGGTCCTTCCTCTGG - Intergenic
902975646 1:20086208-20086230 CACCAATCGGTGCCATCCTTGGG - Exonic
903356554 1:22751686-22751708 CTGCAAGCTGTGCCATCCTCAGG + Intronic
905516816 1:38567883-38567905 TCCCATGCTGTGCCATCCTCTGG - Intergenic
906518874 1:46455829-46455851 CCCCAGTGTGTGCCACCCTCAGG + Intergenic
907248694 1:53123641-53123663 CATCCAGCTGTGCCCTCCTCTGG - Intronic
907339896 1:53727384-53727406 CACCAAGAGCTACCATCCTCTGG + Intronic
909028680 1:70513197-70513219 AACCAAGGAGTGGCATCCTCTGG + Intergenic
912546713 1:110456541-110456563 CCTCAAGCTGTGACATCCTCAGG - Exonic
917727078 1:177838506-177838528 CAACACTGTGGGCCATCCTCAGG + Intergenic
918190057 1:182164910-182164932 CCCCAGGGTGTGCACTCCTCTGG + Intergenic
923052218 1:230396650-230396672 CCCCCATGTGTGCCGTCCTCAGG - Intronic
924149989 1:241120168-241120190 TTCCCAGGTGAGCCATCCTCAGG + Intronic
924537087 1:244944878-244944900 CACCAACATTTGCCATCTTCTGG - Intergenic
1063967628 10:11359292-11359314 CACCCACGTGAGCTATCCTCAGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1072911339 10:99504463-99504485 CACCATAATGTGCCATCCTGTGG - Intergenic
1075579110 10:123603473-123603495 CACCAAGCTCTGCCAGCCCCAGG + Intergenic
1081654872 11:44850468-44850490 CACCCCTCTGTGCCATCCTCCGG - Intronic
1091784155 12:3232110-3232132 TTCCAAAGTTTGCCATCCTCAGG - Intronic
1094439291 12:30457051-30457073 CACCAAGCTGCGCCACCCTGAGG + Intergenic
1097895813 12:64824379-64824401 CACCAAGGGGCGCCAGTCTCAGG - Intronic
1101948625 12:109157171-109157193 CACCAAGCTGTGTGATCTTCTGG + Intronic
1101966393 12:109285194-109285216 CACCAGGGTTGGCCATGCTCTGG + Intronic
1101966412 12:109285301-109285323 CACCAGGGTTGGCCATACTCCGG + Exonic
1104195668 12:126534921-126534943 CTCCAAAGTATGGCATCCTCAGG - Intergenic
1104843799 12:131836896-131836918 CACCCAGGCCTGCCATCCCCAGG + Intronic
1108637641 13:52351561-52351583 CACCAAGCTGTTTCCTCCTCAGG - Intergenic
1112025236 13:95405607-95405629 CACCAAGGCGAGCCATCCCAGGG - Intergenic
1113915705 13:113871900-113871922 TACCAAGATGTACCATCTTCTGG - Intergenic
1116172798 14:41424825-41424847 CACCAAGCTGTCCCCTCCTCTGG - Intergenic
1118808705 14:69258921-69258943 CATCAAGCTCTTCCATCCTCTGG + Intergenic
1121732205 14:96194631-96194653 TAAGAAGGTATGCCATCCTCTGG - Intergenic
1121898708 14:97672812-97672834 CCCACAGGTGTCCCATCCTCAGG - Intergenic
1123934111 15:25185899-25185921 CACCAATGTGTCCCACCCCCGGG - Intergenic
1123942335 15:25222613-25222635 CACCAACTTGTTCCATCCCCAGG - Intergenic
1124717283 15:32076081-32076103 TACCAAAATGTGCCATACTCTGG - Intronic
1126676030 15:51159938-51159960 CTCCTAGGTGTGCCTGCCTCTGG + Intergenic
1128895970 15:71374334-71374356 CATCAGGGTGTGCTATCTTCTGG + Intronic
1128954635 15:71927049-71927071 CACCAAGTGGGCCCATCCTCAGG + Intronic
1131838732 15:96415217-96415239 CACCTCGGTTTGCCAACCTCTGG + Intergenic
1132559592 16:587343-587365 GACAGAGGGGTGCCATCCTCTGG - Intergenic
1133919781 16:10141734-10141756 CACTATGGCATGCCATCCTCAGG + Intronic
1138549275 16:57738712-57738734 GACCAAAGTGTGCCTTCCTTGGG - Intronic
1144875582 17:18395395-18395417 CCCCAGGATGTGCCATCCTTAGG - Intergenic
1145156644 17:20549026-20549048 CCCCAGGATGTGCCATCCTTAGG + Intergenic
1149591278 17:57831666-57831688 CACAAAGGAGTGCCAGCGTCAGG + Intergenic
1160054982 18:75470645-75470667 CACCAGGGTGTGGCATGTTCTGG + Intergenic
1161900385 19:7114319-7114341 CAGCAAGGTGTACCTTCCTTTGG - Intronic
1162871648 19:13591043-13591065 CACCAGGGTGGTCCAGCCTCAGG - Intronic
928216410 2:29365098-29365120 CACCGAGGTGTGCTGTCCTCAGG + Intronic
929533567 2:42767079-42767101 CCCCCAGGTGTGCGTTCCTCAGG + Exonic
929780916 2:44956293-44956315 CTCCAAGGTGTGGCAGCGTCAGG - Intergenic
931763278 2:65434534-65434556 AACCAAGCTGTTCCATCCCCTGG - Intergenic
936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG + Intronic
936376155 2:111943059-111943081 AACCAGGCTGTGCTATCCTCTGG + Intronic
937244272 2:120482485-120482507 CACCAGGGTGGGACTTCCTCGGG + Intergenic
938256481 2:129863489-129863511 CTCCCAGGTGTCCCCTCCTCAGG + Intergenic
942228458 2:173837357-173837379 CACCAAGATGGGCCATGCTTGGG + Intergenic
945046888 2:205789558-205789580 CAGCTAGGTCTGCCATCCTGTGG + Intronic
1173169756 20:40714373-40714395 CACCCTGATGGGCCATCCTCGGG + Intergenic
1175596216 20:60236211-60236233 AAGAAAGGTGTGCCAGCCTCAGG + Intergenic
1176724017 21:10414892-10414914 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1176795954 21:13371492-13371514 CACAGAGCTGTGCCATCTTCAGG + Intergenic
1179449711 21:41460178-41460200 CACCAAGGTGTGACATCCTCTGG + Intergenic
1180305261 22:11068066-11068088 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1180871136 22:19148054-19148076 CAGCAATCTGTGCCATCCTAGGG - Intergenic
1183362127 22:37388148-37388170 CAGCAGGGAGTGCCATGCTCAGG - Intronic
1183377521 22:37473768-37473790 CCCCAAGTTGGCCCATCCTCAGG - Intronic
1184017301 22:41795737-41795759 CAGCCAGGTGTCCCATGCTCTGG - Exonic
951127329 3:18998979-18999001 CACCAAGGTGTGCAATCCTGAGG - Intergenic
953497619 3:43402060-43402082 CACCGAGGTTTGTCAGCCTCTGG - Intronic
954329215 3:49880633-49880655 CACCACTGGGTGCCATGCTCAGG + Intergenic
954779952 3:53051545-53051567 CTCCTGGGTGTGCCAGCCTCTGG - Intronic
959015751 3:101132131-101132153 CACCAATGTATTCCTTCCTCTGG - Intergenic
964905898 3:161720286-161720308 CACCAATGTGTGCCACACTGTGG - Intergenic
965752375 3:171989673-171989695 CACCCAGTTGTGGCAGCCTCGGG - Intergenic
966635501 3:182128804-182128826 CACCAAGGCGTGGCAGCCCCTGG + Intergenic
967102886 3:186230709-186230731 CCCCAAGATGTTCCATCCTCAGG - Intronic
976012687 4:80510420-80510442 CACAGAGGTGTGCCATCTTGAGG - Intronic
978143275 4:105341836-105341858 CACCAAGGAATCCCATCCCCTGG - Intergenic
981284863 4:143005148-143005170 CACTAAGCAGTGCCATCCTGGGG - Intergenic
983104716 4:163672363-163672385 CACCAAGCTGTGCCGTGCTGAGG - Intronic
985811283 5:2089246-2089268 TACCAAGGTGGACCATGCTCTGG + Intergenic
986518311 5:8586636-8586658 CCCCGGGATGTGCCATCCTCAGG + Intergenic
997822661 5:137079798-137079820 CACCCAGGCGTGTCCTCCTCTGG + Intronic
999727507 5:154448463-154448485 CACCAAGGTGATCCCTCCTTAGG + Intronic
1001707250 5:173750481-173750503 CATTAGGGTGTGCCCTCCTCTGG + Intergenic
1001778152 5:174344611-174344633 CACCCAGCTCTGCCCTCCTCTGG - Intergenic
1002026660 5:176400534-176400556 CACAAGGGTGTGGCACCCTCTGG + Intronic
1002436354 5:179234270-179234292 CACCCAGGTGGGCAGTCCTCAGG + Intronic
1002724156 5:181283423-181283445 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1002922093 6:1580080-1580102 GACCAAGGTCTGCTATCTTCCGG + Intergenic
1003098549 6:3159816-3159838 CCCCAAGGAGAGCCATTCTCTGG - Intergenic
1007991295 6:46258966-46258988 CCCCAAGGTGTGAAATCTTCAGG - Intronic
1012381802 6:98629108-98629130 CACCAAGCTCTGTCATCTTCAGG + Intergenic
1014171727 6:118286301-118286323 TACCAAGGTGCCCCATCATCTGG - Intronic
1016783001 6:147980589-147980611 GACTAAGGTTTGCCATCCCCTGG + Intergenic
1036429321 8:8675195-8675217 GACCACGGTGTGACAACCTCAGG + Intergenic
1036824505 8:11965698-11965720 CACCTTGGTGTGCCATCGCCCGG - Intergenic
1038692882 8:29779304-29779326 CACACAGGTGGGCCAGCCTCTGG + Intergenic
1039415827 8:37393564-37393586 CGCCAGGGTGGGCCAACCTCTGG + Intergenic
1049222635 8:141434931-141434953 CAGCCAGGTGTGCTCTCCTCCGG - Intergenic
1049306852 8:141908511-141908533 CCCCAAGCTGTGCCAGCCTCTGG + Intergenic
1051162143 9:14220736-14220758 CATCAAGGTGTAACTTCCTCAGG + Intronic
1052508992 9:29390432-29390454 TACCCAGGTGTACCACCCTCCGG + Intergenic
1053255420 9:36613148-36613170 CGCTAAGGTGTGCCTGCCTCAGG + Intronic
1053886297 9:42646856-42646878 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1054225317 9:62454305-62454327 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1056424799 9:86465578-86465600 CACCAAGGGGTGCTATGCTCTGG - Intergenic
1060970338 9:127734245-127734267 CACCATGGGGTGCCACCCTAGGG - Intronic
1062712883 9:137986292-137986314 CACCTAGGTGTGCAGCCCTCAGG + Intronic
1185888514 X:3803477-3803499 CACCAATGTTTCCTATCCTCTGG + Intergenic
1189802598 X:44705777-44705799 CACAAAGCTCTGTCATCCTCAGG + Intergenic
1193425764 X:81338509-81338531 CACCAGGGTATGGCATCCTTGGG - Intergenic
1200773556 Y:7149727-7149749 CACCAATGTTTTCTATCCTCTGG - Intergenic