ID: 936088472

View in Genome Browser
Species Human (GRCh38)
Location 2:109485992-109486014
Sequence GAGCGCACACACTGATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936088472_936088474 1 Left 936088472 2:109485992-109486014 CCACAGAATCAGTGTGTGCGCTC 0: 1
1: 0
2: 3
3: 3
4: 85
Right 936088474 2:109486016-109486038 AGCCAGAAGTCCAGCACTGTAGG 0: 1
1: 0
2: 0
3: 31
4: 347
936088472_936088475 2 Left 936088472 2:109485992-109486014 CCACAGAATCAGTGTGTGCGCTC 0: 1
1: 0
2: 3
3: 3
4: 85
Right 936088475 2:109486017-109486039 GCCAGAAGTCCAGCACTGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936088472 Original CRISPR GAGCGCACACACTGATTCTG TGG (reversed) Intronic