ID: 936088572

View in Genome Browser
Species Human (GRCh38)
Location 2:109486716-109486738
Sequence ATGTGTTAGAGGAAGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 563}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936088559_936088572 20 Left 936088559 2:109486673-109486695 CCACACCTGCAGAGTTTGCACCC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG 0: 1
1: 0
2: 4
3: 50
4: 563
936088563_936088572 0 Left 936088563 2:109486693-109486715 CCCAGCAGTGTGGTTGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 713
Right 936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG 0: 1
1: 0
2: 4
3: 50
4: 563
936088565_936088572 -1 Left 936088565 2:109486694-109486716 CCAGCAGTGTGGTTGGCGCAGGA 0: 1
1: 0
2: 3
3: 8
4: 157
Right 936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG 0: 1
1: 0
2: 4
3: 50
4: 563
936088560_936088572 15 Left 936088560 2:109486678-109486700 CCTGCAGAGTTTGCACCCAGCAG 0: 1
1: 0
2: 1
3: 32
4: 158
Right 936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG 0: 1
1: 0
2: 4
3: 50
4: 563
936088558_936088572 26 Left 936088558 2:109486667-109486689 CCTTCACCACACCTGCAGAGTTT 0: 1
1: 0
2: 1
3: 54
4: 952
Right 936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG 0: 1
1: 0
2: 4
3: 50
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936088572 Original CRISPR ATGTGTTAGAGGAAGGGGAG GGG Intronic
900088155 1:908519-908541 AGGTGACAGAGGGAGGGGAGGGG + Intergenic
900479218 1:2890028-2890050 AGGTGGTAGAGGAAGGTGAAGGG + Intergenic
901004092 1:6163358-6163380 ATGTGGTGGAGGCAGGGCAGAGG - Intronic
901384210 1:8896530-8896552 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
901917406 1:12510485-12510507 AAGTGGGAGAGGAAAGGGAGGGG - Exonic
902502193 1:16918465-16918487 AAGGGTTGGAGGAAGGGGACAGG - Intronic
902658396 1:17885154-17885176 GTGTGTTAATGGAGGGGGAGAGG + Intergenic
902785437 1:18730068-18730090 AGGTGAAAAAGGAAGGGGAGGGG + Intronic
902917510 1:19647559-19647581 AGGTGGGAGAGGCAGGGGAGGGG + Intronic
902942982 1:19813887-19813909 CAGTGTTAGAGGAAGCGCAGTGG + Intergenic
903026144 1:20430968-20430990 ATGGGTGAGAGGAGGTGGAGAGG - Intergenic
903270869 1:22187485-22187507 AGGGGCTGGAGGAAGGGGAGGGG - Intergenic
903725306 1:25438191-25438213 ATGGGGTTGAGGAAGGGGAGGGG + Intronic
903869074 1:26419236-26419258 ATGTGTTTTAGAAAGGGGCGGGG + Intronic
904041106 1:27585777-27585799 AACAGTTGGAGGAAGGGGAGGGG - Intronic
904131898 1:28281589-28281611 GTGTGTGAGAGGAGGAGGAGAGG + Exonic
904649174 1:31991613-31991635 ATGAATTAGAGAAAGAGGAGAGG - Intergenic
905068267 1:35202586-35202608 TTGTGTTGGGGGATGGGGAGAGG + Intergenic
905544980 1:38790476-38790498 ATTTGGTAGAGGCAGGGGAGAGG + Intergenic
905585633 1:39115374-39115396 ATGTGGTATATGAGGGGGAGAGG + Intronic
905867449 1:41383600-41383622 TTGGGCTAGAGGAAGGGGAGTGG + Intergenic
906092987 1:43198625-43198647 CTCTGTTAGAGGATGCGGAGAGG + Exonic
906113173 1:43338035-43338057 ATGTTTATGTGGAAGGGGAGGGG - Intronic
906151511 1:43590546-43590568 ATGTGTAATAGGCAGGGGAAGGG - Intronic
907049760 1:51322051-51322073 ATCTGTTGGAGGTGGGGGAGGGG + Intronic
907989800 1:59568669-59568691 ACGTGGTGGAGGAAGGGAAGAGG - Intronic
908659153 1:66419305-66419327 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
908854114 1:68405346-68405368 ATGAGTAAAAGGAAGGAGAGAGG + Intergenic
909684766 1:78335441-78335463 CTTTCTTAGAGGAAGGAGAGTGG + Intronic
910857376 1:91709030-91709052 TTTTGTGAGAAGAAGGGGAGGGG - Intronic
910934555 1:92476563-92476585 ATGTTCAACAGGAAGGGGAGGGG + Intronic
910982858 1:92975878-92975900 GTTTGGTAGAGGATGGGGAGAGG - Intergenic
911192183 1:94959153-94959175 ATGTTTTATAAGAAGTGGAGGGG + Intergenic
911236720 1:95420090-95420112 ATGTGTGTGAGGAAGAGGATGGG + Intergenic
911258395 1:95659095-95659117 ATGTTGTAGAGGAAAGGGATAGG + Intergenic
911884927 1:103286417-103286439 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
912458300 1:109814249-109814271 AGCTGTTAGAGGAGGGGAAGTGG - Intergenic
914675707 1:149905848-149905870 ATGTGTTGGAGGCAGGGCAGTGG - Intronic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
915314353 1:155019571-155019593 ACGTGTTAGAGCAGGGGCAGTGG - Intronic
915936492 1:160092916-160092938 ATGTGCGGGAGGAAGGTGAGAGG - Exonic
916065299 1:161131899-161131921 AAGTTTGGGAGGAAGGGGAGTGG - Intronic
916325724 1:163557647-163557669 GTGTGGCAGAGGACGGGGAGTGG - Intergenic
916523865 1:165590984-165591006 TTGTGATAGAGGGAGGGCAGAGG - Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
916932112 1:169589287-169589309 TTGTGTTACAGGAAGAGAAGAGG + Exonic
918136137 1:181675485-181675507 ATGTGTTAAGAGAAGGGGATGGG + Intronic
918154260 1:181830540-181830562 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
918666532 1:187157682-187157704 ATGTGGTTGAGTAATGGGAGTGG + Intergenic
921113982 1:212069276-212069298 ATTTGGAAGAGGGAGGGGAGAGG - Intronic
921707902 1:218345461-218345483 AAGTGAAAGAGGCAGGGGAGGGG + Intergenic
922015892 1:221646517-221646539 ATTTGTTGGAGTCAGGGGAGGGG + Intergenic
922128025 1:222748289-222748311 ATGTTTTAGAGGGAGGGAATTGG + Intronic
922236925 1:223728913-223728935 ATCTGTTATAGGAAGAGCAGTGG + Intronic
923871268 1:237996497-237996519 GTGTGTTTGGGGAATGGGAGGGG + Intergenic
1063255257 10:4320671-4320693 CTGTGTTGGAGGAAGATGAGAGG - Intergenic
1063348060 10:5329629-5329651 TGGAGTTAGAGGAAGGGGAAGGG - Intergenic
1065762342 10:28993892-28993914 AAGTGTTAGAGCAAAGAGAGTGG + Intergenic
1065874178 10:29982957-29982979 AAGGGACAGAGGAAGGGGAGAGG + Intergenic
1066357114 10:34695568-34695590 ATGAGGAAGAGGAAGAGGAGGGG - Intronic
1066515021 10:36149041-36149063 ATGTGCATGAGGAATGGGAGAGG - Intergenic
1066613920 10:37277634-37277656 AGGAGCTAGTGGAAGGGGAGGGG + Intronic
1067793000 10:49301821-49301843 CTGTCTTAGATGAAGGGGAAAGG + Intronic
1067831137 10:49611650-49611672 GTGGGTTCGAGGAAGGCGAGGGG - Exonic
1068313991 10:55318254-55318276 ATGTGTTGGGGGCAGGGGTGTGG + Intronic
1068628269 10:59272630-59272652 ATGTTTTAGAGGAAAGGGTCTGG + Intronic
1069852487 10:71419143-71419165 ATGTCTTAGAGGGCAGGGAGAGG - Intronic
1070497973 10:77041755-77041777 ATGGGTAAGAGGAAGATGAGAGG + Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1070809966 10:79292812-79292834 ATGGGTTAGGGGATGAGGAGAGG + Intronic
1072161758 10:92773747-92773769 GTATGTTGGAGGTAGGGGAGTGG - Intergenic
1072201947 10:93168181-93168203 ATGTGTCAGAGGAGGGGTATGGG - Intergenic
1072370987 10:94766278-94766300 AGGAGCTAGTGGAAGGGGAGGGG + Intronic
1072478589 10:95787424-95787446 AGGTGTTTTAGGAAGGAGAGGGG + Intronic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1075022446 10:118961612-118961634 ATGGATTAGAGGAGGGGCAGGGG - Intergenic
1075436721 10:122449997-122450019 AGCTTTTAAAGGAAGGGGAGAGG + Intergenic
1075478797 10:122761233-122761255 ATGTGGTAGAGAAGGGAGAGTGG + Intergenic
1077339447 11:2019532-2019554 AGCTGTGAGAGGAAGGGAAGGGG - Intergenic
1077571040 11:3338889-3338911 ATGTGAAAGTGGTAGGGGAGGGG + Intergenic
1077573364 11:3357427-3357449 ATGTCTTTGAGGGAGGGGATTGG + Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1079245022 11:18745537-18745559 GTGTGTGGGAGGCAGGGGAGGGG - Intronic
1079289920 11:19178785-19178807 AAGTGTGAGAGGAAGGAGAAGGG + Intergenic
1079459243 11:20665575-20665597 ATGGGTTGGAGGAAGGTGGGAGG + Intergenic
1079954654 11:26847970-26847992 ATGTGTTATAGGTTGGGGAGAGG + Intergenic
1080046516 11:27814292-27814314 ATGTGTTAGTTGAGGGGAAGTGG + Intergenic
1080225554 11:29956357-29956379 ATGTGTTAGAGGCAGATGAGAGG - Intergenic
1080943350 11:36944013-36944035 GTGTGTGAAAGGAAGGAGAGGGG + Intergenic
1081690498 11:45074656-45074678 ATGTGTGAGAGGCAGGGCAGAGG + Intergenic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082234086 11:49801434-49801456 ATGGGGAAGAGGAAGGGAAGGGG - Intergenic
1082835103 11:57645840-57645862 ATATGGTGGAGGCAGGGGAGGGG + Exonic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083659498 11:64245649-64245671 AGGTGTTTGGGGGAGGGGAGGGG - Intronic
1086617505 11:88840010-88840032 ATGGGGAAGAGGAAGGGAAGGGG + Intronic
1086623129 11:88912535-88912557 ATGTGTTGGTGGGAGGGGGGAGG + Intronic
1087239568 11:95759520-95759542 ATCTGTTAGAGGTAAGAGAGTGG - Intergenic
1087682670 11:101233651-101233673 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1088596494 11:111444877-111444899 CTCTGTGAGAGGCAGGGGAGTGG + Intronic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089284346 11:117396017-117396039 ATGAGTGAGAGGCAGGGCAGCGG - Intronic
1090293345 11:125565777-125565799 ATATGGTAGAGGAAAGGGTGTGG + Intergenic
1090475125 11:127013376-127013398 ATGTTTTGGAAGATGGGGAGGGG - Intergenic
1090588801 11:128242478-128242500 TTGTGAGAGAGGAAGAGGAGAGG - Intergenic
1202822432 11_KI270721v1_random:74721-74743 AGCTGTGAGAGGAAGGGAAGGGG - Intergenic
1091544208 12:1490100-1490122 ATGAGTTAGAGAAAGGTGAACGG + Exonic
1091547341 12:1510230-1510252 ATGGGTTAGAGGCCGGGGAAGGG - Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091835222 12:3581040-3581062 ATGTGGTGGAGGAAGGGGCTTGG + Intronic
1092386335 12:8038314-8038336 ATGTGTTGGAGTCAGGAGAGAGG + Intronic
1092526446 12:9312784-9312806 ATAAGTCTGAGGAAGGGGAGGGG + Intergenic
1092847471 12:12596981-12597003 ATGGGGTAGGGGGAGGGGAGAGG + Intergenic
1093173076 12:15881024-15881046 ATGTGTGAGACAAAAGGGAGAGG + Intronic
1093429336 12:19066306-19066328 ATTTGTTAGAGAAAGGGGGTTGG - Intergenic
1094228443 12:28074614-28074636 TTTTGTTAGAGGAAGAGGAAAGG - Intergenic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1094331964 12:29303559-29303581 AGGTGTGAGAGGCAGGGGAATGG + Intronic
1094512216 12:31103484-31103506 ATAAGTCTGAGGAAGGGGAGGGG + Intronic
1094599750 12:31898186-31898208 AGGAGGGAGAGGAAGGGGAGTGG + Intergenic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1096966320 12:55630939-55630961 AAGTGTTTCAGGAAGAGGAGGGG + Intergenic
1098153034 12:67567810-67567832 ATGTGTTAGAGGTTAGAGAGAGG - Intergenic
1098985030 12:77002865-77002887 ATGTGTTTGAGGCTGGGGATGGG - Intergenic
1099033278 12:77555457-77555479 ATTTGTAAAAGGATGGGGAGGGG - Intergenic
1099259791 12:80363518-80363540 ATGTGTTGGGGGTTGGGGAGTGG + Intronic
1099764708 12:86969011-86969033 ATGGGGTGGGGGAAGGGGAGAGG - Intergenic
1099901573 12:88716835-88716857 ATTTATTTGTGGAAGGGGAGGGG + Intergenic
1099993918 12:89756042-89756064 AAGTGCTAGAGGAAAGGTAGGGG + Intergenic
1100379307 12:94046868-94046890 ATTTGTTGGGGGGAGGGGAGAGG + Intergenic
1100529529 12:95450934-95450956 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1100934625 12:99648758-99648780 CTGTGTTGGAGGAAGTGCAGAGG + Exonic
1101085452 12:101231004-101231026 ATGTGTTACAAGAAGAGGTGTGG - Intergenic
1101152804 12:101898775-101898797 ACCTGTTAGAGAAAGGGGACAGG + Intronic
1101584439 12:106072685-106072707 ATGTGTATGGGGCAGGGGAGGGG - Intronic
1101705278 12:107215499-107215521 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
1102780231 12:115557954-115557976 AAATGTTAGAGGAAAGGGTGGGG - Intergenic
1103132858 12:118483764-118483786 ATGTTGTAGAGGGAGGGGAATGG + Intergenic
1104490223 12:129187453-129187475 ATGTGGTAGTGGAAGAGCAGGGG + Intronic
1104615414 12:130264175-130264197 ATGTGTTAGTGGCAGAGCAGGGG - Intergenic
1104768207 12:131344278-131344300 AGGAGCTAGAGGAAGGGGAGGGG + Intergenic
1107206988 13:37803718-37803740 ATGTGTTGGAGGTAGGGGGCTGG + Intronic
1107881780 13:44838803-44838825 ATTTGGTGGAGGAAGGGGAATGG - Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1109549186 13:63870887-63870909 ATGCCTTAGAGGAAGGGGATAGG - Intergenic
1109603643 13:64663647-64663669 ATGTGGTGGAGGTGGGGGAGGGG - Intergenic
1110310041 13:74038221-74038243 CTGTGTCTGAGGAATGGGAGGGG + Intronic
1110344961 13:74435471-74435493 ATTAGATAGAAGAAGGGGAGGGG - Intergenic
1110893989 13:80726337-80726359 ACCTGTCAGGGGAAGGGGAGGGG - Intergenic
1111311847 13:86499587-86499609 ATGTGGGAGAGGAAATGGAGAGG + Intergenic
1111867238 13:93784461-93784483 ATGTTTTTGAGGAAGGGGTTTGG - Intronic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112469500 13:99674693-99674715 ATGCGTAAGAAGAAGTGGAGGGG + Intronic
1112787256 13:102964862-102964884 ATGTGTGAGGGAGAGGGGAGGGG - Intergenic
1113027634 13:105958363-105958385 TTGAGTTAGTGGAATGGGAGAGG - Intergenic
1113082064 13:106530664-106530686 ATGCGTCATAGGAATGGGAGTGG - Intronic
1113550801 13:111191686-111191708 AGGAGCTAGTGGAAGGGGAGGGG + Intronic
1114145356 14:19969898-19969920 AGGTGTTTGAGGAGGGGAAGTGG + Intergenic
1114412888 14:22517418-22517440 AAGTGTCAGAGGCAGGGGAGAGG + Intergenic
1114840106 14:26253163-26253185 GTGTGTTTGAGAAAGGGGAGGGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115300390 14:31878878-31878900 ATTGGTTTGAGAAAGGGGAGGGG + Intergenic
1115635186 14:35284052-35284074 ATGTTTTTGAGCAAGGAGAGTGG - Intronic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1116795338 14:49384216-49384238 ATGTCTTAGAAGCAGGGGATTGG - Intergenic
1118383988 14:65240038-65240060 CTGTGCTAATGGAAGGGGAGTGG - Intergenic
1118500417 14:66357013-66357035 ATATGTTAGAAGAAGAGGAGAGG - Intergenic
1119716894 14:76866128-76866150 GTGTGTCAGAGAGAGGGGAGAGG + Intronic
1120844004 14:89110852-89110874 ATGTCTTTGATGAAGGGAAGTGG - Intergenic
1120857171 14:89222791-89222813 ATTTTTTAAAGGAAGGGTAGAGG - Intronic
1121219023 14:92271955-92271977 AAGTGAGAGAAGAAGGGGAGAGG - Intergenic
1122307701 14:100776273-100776295 ATGGGTGGGAGGAAGGGAAGTGG + Intergenic
1122905139 14:104798143-104798165 ATGGGCTAGATGAAGGGGAGGGG - Intergenic
1122972217 14:105156979-105157001 ATGGGTTGGAGGAGGGAGAGCGG - Intronic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1124914102 15:33951619-33951641 ATTTGTTAGAGGAGGGAAAGGGG - Intronic
1125580699 15:40783402-40783424 ATGGGTGAGAGGAAGGGAGGGGG + Intronic
1126746966 15:51836105-51836127 ATATGTTAGAGAAAGGGGGAAGG - Intronic
1126800483 15:52293420-52293442 AGGTGTCAGAGGGAGGGGATGGG - Intronic
1127318891 15:57823498-57823520 ATGTGTTAGCTGATGGGGAAAGG + Intergenic
1127555157 15:60080556-60080578 ATGTGGAGGAGGAAGAGGAGAGG + Intergenic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1128545568 15:68565422-68565444 ATGAGTCAGAGTTAGGGGAGGGG - Intergenic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128772036 15:70290034-70290056 AACTGGTGGAGGAAGGGGAGAGG + Intergenic
1129235365 15:74220589-74220611 ATGTGTGCGAGGGAGGGGAAAGG + Intergenic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1130287169 15:82565659-82565681 ATGGATTAGAGGAGGGGGAGGGG + Intronic
1130353747 15:83112103-83112125 ATGTTCTACAGGAAAGGGAGTGG - Intronic
1130642247 15:85688808-85688830 ATGTGTTTGTGGAAGATGAGAGG + Intronic
1130806118 15:87324981-87325003 ATGTGTGTGAGGCAGGTGAGGGG + Intergenic
1130965586 15:88695365-88695387 TGGTGTTAGAGGAAGGGCGGGGG - Intergenic
1131170630 15:90175439-90175461 AAGTCCTGGAGGAAGGGGAGGGG + Intronic
1131764792 15:95663844-95663866 ATGTGTTGGAGGAGGGGGGAGGG + Intergenic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1133813201 16:9177267-9177289 ATGGGAAAGGGGAAGGGGAGAGG - Intergenic
1134853548 16:17501276-17501298 TGGTGGTAGAGGAAGGTGAGTGG - Intergenic
1135210484 16:20521751-20521773 ATGTCTTGGAGGCAGGGAAGAGG + Intergenic
1135267418 16:21039562-21039584 ATGTGTTAGAGTGAGAGGTGAGG + Intronic
1135472671 16:22745482-22745504 ATGAGTTATAGGCAGGGAAGAGG + Intergenic
1135724760 16:24845942-24845964 ACGAGCTGGAGGAAGGGGAGGGG - Exonic
1135887760 16:26327233-26327255 ATGTGGTGGAGGATGGGGTGTGG - Intergenic
1136930116 16:34410920-34410942 ATGTGGCAGAGGAGGGAGAGGGG - Intergenic
1136974458 16:35000885-35000907 ATGTGGCAGAGGAGGGAGAGGGG + Intergenic
1137571849 16:49571521-49571543 AAGTGTCAGATGGAGGGGAGGGG + Intronic
1137932576 16:52603003-52603025 CTGTGTTGGAGGGAGAGGAGAGG - Intergenic
1138272374 16:55704488-55704510 ATGTGTTGGAGGATGGGAAGGGG + Intronic
1139286880 16:65823184-65823206 ACGTGTTAGAGAAAAGAGAGAGG + Intergenic
1139594239 16:67948823-67948845 TTGGGTGAGAGGAAGGGGTGTGG + Intronic
1140526490 16:75627257-75627279 ATGTTTTTGAGGAATGGCAGAGG - Intergenic
1140780872 16:78295210-78295232 ATGTGTTAGAGCAGAGAGAGTGG + Intronic
1140819175 16:78647272-78647294 ATGCTTTACAGGAAGGGGAGTGG + Intronic
1140992658 16:80229282-80229304 ATGTGATAGAGGAAAAGGAGAGG - Intergenic
1141720360 16:85752201-85752223 CTTTGTTAGAGGCGGGGGAGTGG - Intergenic
1142275208 16:89114787-89114809 ATGTCTCAGAGGAAGGCGGGGGG + Intronic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143476954 17:7208368-7208390 ATGGGCTAGAGGAGAGGGAGGGG - Intronic
1143853909 17:9834398-9834420 ATCTGTTAAAGGAATGGGGGTGG + Intronic
1144052434 17:11508563-11508585 AGGTGGGAAAGGAAGGGGAGGGG - Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144350406 17:14389761-14389783 ATGCGTTGGGGGAGGGGGAGAGG - Intergenic
1145804764 17:27718688-27718710 AAGAGCTAGTGGAAGGGGAGAGG - Intergenic
1146311172 17:31769562-31769584 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
1146950038 17:36899624-36899646 AGCTGGGAGAGGAAGGGGAGAGG + Intergenic
1147807250 17:43140595-43140617 ATGGCTTAGAAGAAGGGAAGTGG - Intergenic
1147882344 17:43661992-43662014 ATGTGAGAGAGGAGAGGGAGGGG + Intergenic
1147965442 17:44192150-44192172 TGCTGTTAGAGGGAGGGGAGTGG + Exonic
1148169147 17:45504852-45504874 ATGGTTTAGAAGAAGGGAAGTGG - Intergenic
1148279675 17:46338155-46338177 ATGGTTTAGAAGAAGGGAAGTGG + Intronic
1148301892 17:46556011-46556033 ATGGTTTAGAAGAAGGGAAGTGG + Exonic
1148366375 17:47058523-47058545 ATGGCTTAGAAGAAGGGAAGTGG + Intergenic
1148396033 17:47308971-47308993 AAGCGTAAAAGGAAGGGGAGGGG - Intronic
1148792970 17:50183936-50183958 AAGGGTGAGAGAAAGGGGAGTGG + Exonic
1149737975 17:59014735-59014757 ATGTGTTGGCGGTAGGGGGGCGG - Intronic
1149906890 17:60534753-60534775 ATGAGTGATTGGAAGGGGAGGGG + Intergenic
1150400341 17:64851318-64851340 ATGGTTTAGAAGAAGGGAAGTGG - Intergenic
1150547309 17:66173057-66173079 ATGTGATTTAAGAAGGGGAGAGG - Intronic
1150707842 17:67503669-67503691 ATTTTTTAGAGGAAAGGGAGAGG + Intronic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151381602 17:73729654-73729676 ATGGGTGATAGGAAGGGGACGGG - Intergenic
1152276481 17:79360858-79360880 TTATGTTGGGGGAAGGGGAGTGG + Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152648933 17:81483045-81483067 GTGAGTTAGTGGAGGGGGAGTGG + Intergenic
1152932249 17:83115872-83115894 ATGTGCTGGAGGAAGGTGTGGGG - Intergenic
1153010283 18:532397-532419 ATGGTCAAGAGGAAGGGGAGAGG - Intergenic
1154339308 18:13489862-13489884 ATGGGTTAGAAGAAGGAGGGAGG + Intronic
1154354130 18:13611889-13611911 ATCAGTTAGAGGATGTGGAGAGG + Intronic
1154462489 18:14607546-14607568 AGGTGTTTGAGGAGGGGAAGTGG + Intergenic
1155566257 18:27138013-27138035 AAGTGCTAGAAGGAGGGGAGTGG - Intronic
1156519784 18:37712578-37712600 GTGTGTGTGAGGGAGGGGAGGGG - Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157340564 18:46774061-46774083 AGGTGTTGGAGGAAGAGAAGTGG + Intergenic
1157422045 18:47555665-47555687 ATGTGTGGAAGGAAAGGGAGAGG - Intergenic
1157434271 18:47655152-47655174 ATGTGTGGCAGGAAAGGGAGGGG - Intergenic
1157637325 18:49171362-49171384 GTGTGTTAGAGGAAGGACTGAGG - Intronic
1157690630 18:49678934-49678956 ACGTGGGAGAGGAAGGGGAGGGG + Intergenic
1158302019 18:56063098-56063120 ATGTGTTAGAGGTATGGCTGAGG - Intergenic
1158892699 18:61887874-61887896 ATGCGATAGTGGCAGGGGAGAGG + Intronic
1159659851 18:71080946-71080968 AAGATTGAGAGGAAGGGGAGGGG + Intergenic
1160051399 18:75437449-75437471 ATGGGGGAGGGGAAGGGGAGAGG + Intergenic
1160473078 18:79156520-79156542 ATTTGATAATGGAAGGGGAGGGG - Intronic
1161415772 19:4145576-4145598 ATGAGAGAGAGGATGGGGAGGGG + Intergenic
1162021946 19:7872122-7872144 AGGGGCTAGAGGAAGGGGCGTGG + Exonic
1162160193 19:8708200-8708222 ATGGGGTGGGGGAAGGGGAGAGG - Intergenic
1162188724 19:8927779-8927801 ATGGGTGAGAGGTAGGGGAGGGG + Intronic
1162419943 19:10560398-10560420 CTGAGTTGGATGAAGGGGAGCGG - Exonic
1162428994 19:10615617-10615639 AAGAGGAAGAGGAAGGGGAGGGG + Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1163198677 19:15746046-15746068 ACGTGGAGGAGGAAGGGGAGGGG - Intergenic
1164854679 19:31511765-31511787 ATGTGCTAGAGCGTGGGGAGTGG - Intergenic
1166746802 19:45145603-45145625 AGGAGGAAGAGGAAGGGGAGAGG + Exonic
1166773638 19:45299574-45299596 ATGTGGAAGATGAAAGGGAGGGG - Intronic
1167374673 19:49104344-49104366 ATGTGGGAGAGGAAGGGCCGGGG + Intronic
1167485923 19:49762981-49763003 GGGTGCTAGAGGAAGGGGAGGGG - Intronic
1167517235 19:49930336-49930358 ATATTTTAGAGGAAGGGGCGTGG + Intronic
1167586914 19:50380574-50380596 CGGAGTAAGAGGAAGGGGAGAGG - Intronic
1168284101 19:55321906-55321928 AAGGGTGAGAGGAAGGAGAGTGG - Intronic
925250591 2:2433825-2433847 ATGTGATAGAGGAAGGGGAAGGG + Intergenic
926351234 2:11996649-11996671 GGGTGTTAGAGGGAGGGCAGGGG + Intergenic
926765359 2:16318989-16319011 AAGTTTGTGAGGAAGGGGAGGGG + Intergenic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927308587 2:21602385-21602407 GTTTGTTTGAGGCAGGGGAGTGG + Intergenic
927475486 2:23411302-23411324 ATGTGTCAGAGGAAGTGTTGTGG + Intronic
927475576 2:23412032-23412054 ATGTGTCAGAGGAAGTGTTGTGG + Intronic
927663818 2:25015482-25015504 ATGGGCTTGAGGGAGGGGAGTGG + Intergenic
927868652 2:26609302-26609324 AGGGGGAAGAGGAAGGGGAGAGG + Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
928613976 2:33018184-33018206 ATGTGGTAGGGTAAGGGGGGTGG - Intronic
928718017 2:34085570-34085592 ATGGGGTAGGGGGAGGGGAGAGG + Intergenic
928963682 2:36955711-36955733 GTGTGTTGGAGGTAGGGGACAGG - Intronic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929736234 2:44552933-44552955 ATATTTTAGAGGAAGGGAATAGG + Intronic
930404982 2:50942964-50942986 ATGTGTTGGAGTTAGGGGAGTGG + Intronic
931202400 2:60111024-60111046 CTGAGGTAGAGGAAGGGGAGTGG + Intergenic
932030639 2:68180704-68180726 ATGTGGTGGAGAAAGGGAAGGGG - Exonic
932451950 2:71816750-71816772 ATGTGCTTGATGATGGGGAGGGG + Intergenic
932629101 2:73323063-73323085 ATCTGTGGGAGGAAGGGGAGTGG - Intergenic
932702175 2:73999658-73999680 TTGTGATAGAAGATGGGGAGGGG + Intronic
934044487 2:88161181-88161203 ATTTGTCAAAGGAAGGGGAAAGG - Intergenic
934652322 2:96099744-96099766 AGGAGGTGGAGGAAGGGGAGGGG + Intergenic
934652365 2:96099868-96099890 AAGGGGAAGAGGAAGGGGAGGGG + Intergenic
935619643 2:105117586-105117608 GTGGGTATGAGGAAGGGGAGGGG - Intergenic
935959035 2:108405708-108405730 ATGGTTTAGAGGAGGTGGAGGGG + Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
937905969 2:127052996-127053018 CTGTTTGCGAGGAAGGGGAGAGG - Intronic
937913419 2:127087374-127087396 ATGAGAGAGAGGACGGGGAGGGG - Intronic
938589711 2:132724585-132724607 CTGTGATAGATGAAGGGGAAGGG - Intronic
939192098 2:138929133-138929155 ATGTCTCAGAGTAAGGAGAGGGG - Intergenic
939394186 2:141607537-141607559 ATGTTTTAGAGGGATGGGAAGGG - Intronic
939559598 2:143716961-143716983 ATGTAGTAGAGGCAGGGAAGTGG - Intronic
940138753 2:150469714-150469736 ATGAGCTAGAGGAAGATGAGGGG - Exonic
940348262 2:152650891-152650913 CAGTGTTAGATGATGGGGAGTGG - Intergenic
940515148 2:154675038-154675060 ATGTGTTAATGGACGGGGAAGGG + Intergenic
942784754 2:179688182-179688204 ATGAGTTAGAGGTGGGGAAGGGG + Intronic
944690376 2:202153375-202153397 AAGAGTCAGAAGAAGGGGAGAGG + Intronic
946296604 2:218788775-218788797 ATGTGTTAACAGAATGGGAGTGG - Intronic
946428359 2:219611861-219611883 ATGAGTTTGGGGAAGGGAAGGGG + Intronic
946539257 2:220665841-220665863 TTATGATAGTGGAAGGGGAGAGG - Intergenic
947069311 2:226269035-226269057 AAGTATCATAGGAAGGGGAGGGG - Intergenic
947984301 2:234436034-234436056 GTGTGTCAGAGGGAGGGGTGGGG - Intergenic
948294069 2:236847925-236847947 AAGTGTAGGAGGAGGGGGAGGGG + Intergenic
948294094 2:236848005-236848027 AGGTGTAGGAGGAGGGGGAGGGG + Intergenic
948294105 2:236848045-236848067 GGGTGTAGGAGGAAGGGGAGAGG + Intergenic
948294114 2:236848065-236848087 AGGTGTAGGAGGAGGGGGAGGGG + Intergenic
948294126 2:236848105-236848127 AAGTGTAGGAGGAAGGGCAGGGG + Intergenic
948887398 2:240891121-240891143 GTCTGTGAGAGGAAGGAGAGGGG - Intronic
1168757015 20:325233-325255 AGGGGTTGGAGGAAGGGTAGGGG - Intergenic
1168836836 20:883223-883245 ATGTGTAGGAGGAAGGGCACTGG - Intronic
1168844991 20:938268-938290 ATGAGTGAAAGGAAGGAGAGAGG + Intergenic
1169127559 20:3140868-3140890 ATGGGAGAGAGGGAGGGGAGAGG - Intronic
1171883776 20:30636803-30636825 GGGTGTTGGAGGTAGGGGAGTGG - Intergenic
1172041889 20:32051976-32051998 AGGTGTTAGGGAAAGTGGAGCGG + Intergenic
1172294258 20:33797292-33797314 GTGTGTTTGAGGAAGAGTAGAGG + Intergenic
1172838364 20:37887318-37887340 ATGTGAGGGAGGTAGGGGAGTGG - Intergenic
1173245649 20:41335711-41335733 TAGTCTTAGAGGATGGGGAGGGG - Intergenic
1173731211 20:45329967-45329989 AAGTGATAGAGTAGGGGGAGGGG + Intronic
1174353437 20:49983502-49983524 ATGTGTGTGAGGAGGGGGATTGG + Intronic
1175230627 20:57471299-57471321 ATGTGTTAAAGGAAATGGTGAGG - Intergenic
1175320480 20:58084159-58084181 ATTTGTTAGAGAAAGGACAGTGG + Intergenic
1176812030 21:13550836-13550858 AGGTGTTTGAGGAGGGGAAGAGG - Intergenic
1177346556 21:19879972-19879994 ATATGTTACAGGAATGGGGGCGG - Intergenic
1178344527 21:31813438-31813460 ATGGGTTAGAGGAAAAGAAGAGG - Intergenic
1178413743 21:32387173-32387195 AGGTGTCAGTGGTAGGGGAGGGG - Intronic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1178790682 21:35697322-35697344 TTGAGGGAGAGGAAGGGGAGGGG - Intronic
1179106860 21:38408806-38408828 ATGTGTAGGAGGAAGGGGAGGGG + Intronic
1180130087 21:45821561-45821583 ATGAGTTAGGGGAGGGGGCGGGG - Intronic
1181521115 22:23449302-23449324 ATGAGTTAGAGGAGGTGGCGGGG - Intergenic
1182504733 22:30773599-30773621 ATTTGTTGGAGGAATGGGGGAGG + Intronic
1182712839 22:32333300-32333322 GTCTTTTAGAGGATGGGGAGAGG + Intergenic
1182949209 22:34355856-34355878 ATGTGTTAGAGAGAGGAGACGGG - Intergenic
1183063014 22:35347037-35347059 AAATTCTAGAGGAAGGGGAGAGG - Exonic
1183712874 22:39516260-39516282 ATCCGTTAGAGGTAAGGGAGAGG + Exonic
1184400083 22:44268663-44268685 GTGTTTTAGAGGATGGGGAGAGG + Intronic
1184905775 22:47485485-47485507 AAGTGTTTTAGAAAGGGGAGGGG + Intronic
1203314472 22_KI270736v1_random:173641-173663 ATGAAGTGGAGGAAGGGGAGTGG + Intergenic
951671439 3:25187534-25187556 ATGTGTTAGAGACAGGAGAAAGG + Intronic
952917744 3:38262063-38262085 ATGTGGTAAAGTATGGGGAGAGG + Intergenic
953545462 3:43860982-43861004 ATGACCTGGAGGAAGGGGAGGGG + Intergenic
953552924 3:43918272-43918294 ATATGCTGGAGGAGGGGGAGAGG + Intergenic
953684868 3:45069026-45069048 AGGGGTTAGAAGAAGGAGAGAGG + Intergenic
953716265 3:45319289-45319311 ATGTGTTGGAGTTAGGGTAGGGG + Intergenic
953759047 3:45672626-45672648 ATGAGATGGTGGAAGGGGAGAGG - Intronic
954231635 3:49222339-49222361 AGGAGCTAGGGGAAGGGGAGGGG + Intronic
955108317 3:55922457-55922479 AAGAGTGAGAGAAAGGGGAGGGG - Intronic
955307578 3:57849413-57849435 ATGTGGTATAGGTAGGGCAGGGG - Intronic
955320360 3:57970028-57970050 TTGGGTTAGAGGATGGGGCGAGG + Intergenic
955833643 3:63030427-63030449 AGGAGGAAGAGGAAGGGGAGGGG + Intergenic
956219577 3:66887810-66887832 ATGTGTAAGATGAAGTAGAGAGG + Intergenic
956302119 3:67783253-67783275 AGGAGTTAGGGGATGGGGAGTGG - Intergenic
956526942 3:70175284-70175306 ATGTATTAGACTAGGGGGAGAGG - Intergenic
956695801 3:71918415-71918437 ATGTGGGAGAAGAGGGGGAGAGG - Intergenic
956861730 3:73330940-73330962 AGGGGTTAGAGGGAGGGCAGAGG + Intergenic
957017311 3:75083155-75083177 ATGAGGTAGAGGAAAGCGAGTGG + Intergenic
957625974 3:82652160-82652182 ATGTGTCAGAGGAATCTGAGAGG + Intergenic
958197246 3:90256939-90256961 TAGCGTTAGAGGGAGGGGAGAGG - Intergenic
958420671 3:93926756-93926778 TAGTGTTAGAGGGAGGGGAAAGG - Intronic
958420686 3:93926929-93926951 TAGTGTTAGGGGGAGGGGAGAGG - Intronic
959540080 3:107526183-107526205 GGGTGGTAGAGAAAGGGGAGGGG + Intronic
959710610 3:109382363-109382385 ATTTAGTAGAGAAAGGGGAGAGG - Intergenic
959832045 3:110875677-110875699 AAGTGTTAGAGAACAGGGAGGGG + Intergenic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
961968908 3:130938045-130938067 TTGTTTTAAAGGGAGGGGAGAGG - Intronic
962198288 3:133381182-133381204 ATGTGGTAGAGGGAGAGGATGGG - Intronic
962199055 3:133386501-133386523 ATGTGTGACAGGAAGAAGAGGGG - Intronic
962236376 3:133710875-133710897 AAGAGTGAGTGGAAGGGGAGTGG - Intergenic
963287980 3:143455074-143455096 ATGTGTATCAGGATGGGGAGGGG + Intronic
964041172 3:152263742-152263764 TTATGTTAGAGGCAGGGGTGGGG - Intronic
965157354 3:165080751-165080773 ATGAGGTGGAGGAAGGGGGGAGG + Intergenic
965246396 3:166276663-166276685 ATGAGTAAGAGGAAGGTAAGAGG + Intergenic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965901382 3:173645278-173645300 ATGTCTGTGAGGGAGGGGAGAGG - Intronic
968005183 3:195237912-195237934 AGGGGTGAGAGGAAGCGGAGGGG - Intronic
968064602 3:195751547-195751569 ATGTGTCAGAGGCAAGGTAGGGG - Intronic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
970558102 4:17256253-17256275 ATGTGTTTGAGGAAGAGAAGAGG - Intergenic
970599268 4:17627983-17628005 CTATGTTAGAGAAAGGGGAGAGG - Exonic
970620975 4:17818146-17818168 ATGACTTTGAGGAAGGGGACTGG - Intronic
972687873 4:41368708-41368730 ATGTGTTGGTGGTAGGGCAGGGG + Intronic
972807859 4:42548694-42548716 ATGTGTGAGTGGGAGGGGAAGGG - Intronic
972912931 4:43841177-43841199 CTGGCTTAGAGGAAGGGGAAGGG - Intergenic
972953314 4:44357150-44357172 ATGTGCTAGAGGAAGAGATGTGG - Intronic
973247215 4:48022236-48022258 ATGGGTTAGTGGATGTGGAGTGG - Intronic
973790108 4:54370516-54370538 ATGGGAGAGATGAAGGGGAGAGG - Intergenic
973817355 4:54631402-54631424 ATGTGGTAGAGAAGGGAGAGGGG - Intergenic
974574765 4:63703943-63703965 ATGTCTTTGAAAAAGGGGAGGGG - Intergenic
974864257 4:67561325-67561347 ATTGGCTAGAGGAAGGTGAGAGG + Intronic
975989335 4:80240843-80240865 ATGTAAAGGAGGAAGGGGAGAGG - Intergenic
976679150 4:87735524-87735546 AGGAGTTAGATGAAGGAGAGTGG - Intergenic
977132963 4:93266459-93266481 ATGTGTGTGTGGGAGGGGAGTGG - Intronic
978165828 4:105605381-105605403 ATGTGTGTGAGGAAGGACAGAGG - Intronic
978229650 4:106383914-106383936 ACATTTTAGAGGAAGTGGAGAGG + Intergenic
978949602 4:114542088-114542110 ATTTGTCAGTGGAATGGGAGAGG + Intergenic
979851096 4:125572218-125572240 ATGGGGTAGAGGGAGGGGGGAGG + Intergenic
980518762 4:133902479-133902501 ATGGGGTAGGGGAAAGGGAGAGG + Intergenic
981393850 4:144222784-144222806 TTTTGTTAAAGGAAGGGGAATGG + Intergenic
981622126 4:146713136-146713158 GTGTGTAAGAGGTGGGGGAGGGG + Intronic
982637631 4:157916857-157916879 ATGTGTGTGAGGAGGGAGAGTGG + Intergenic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
984379324 4:178970375-178970397 ATGTGTTCCAGAAAGGGGAGTGG + Intergenic
984939269 4:184917246-184917268 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
985777820 5:1854105-1854127 CTGTGGTAGAGGCAGGGAAGAGG - Intergenic
986038818 5:3967090-3967112 GGGTGTGAGAGGAAGGGAAGTGG - Intergenic
987376306 5:17238363-17238385 AGGTGTTAGTTGAAAGGGAGGGG - Intronic
988352559 5:30130531-30130553 ATGGGGTGGGGGAAGGGGAGAGG - Intergenic
988907849 5:35808391-35808413 ATGGGGTGGGGGAAGGGGAGAGG - Intronic
989132404 5:38120302-38120324 ATGTGTAAGAGCAAGGGGCTGGG - Intergenic
989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG + Intergenic
991306491 5:65181873-65181895 ATGTGAAGGAGGCAGGGGAGTGG - Intronic
991648649 5:68828759-68828781 ATGTGTAAGATGAAGTGGACAGG - Intergenic
991957710 5:72012436-72012458 ATGGGTTAGAGGAGGAAGAGGGG - Intergenic
992050024 5:72933309-72933331 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993474531 5:88348345-88348367 ATGGGGTAGGGGGAGGGGAGAGG - Intergenic
993808549 5:92443226-92443248 AGGTGTCAGAGGAGGGAGAGAGG + Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995546793 5:113240551-113240573 ACGTATCAGAGGAAGGGGAGTGG - Intronic
995608962 5:113889185-113889207 ATGTGGTTGAGGAAGATGAGTGG + Intergenic
995707071 5:114997396-114997418 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
996933958 5:128926618-128926640 AAGTGTTAGTGGAAGGAAAGAGG - Intronic
997072954 5:130640038-130640060 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
997179173 5:131810757-131810779 ATGTGATAGAGGAGGTGGTGTGG - Intronic
997374158 5:133384945-133384967 ATGGGTTAGAGAAAGAGGAGGGG - Intronic
997594094 5:135094859-135094881 ATGAGTGAGAGGAAGAGAAGAGG - Intronic
997849598 5:137319379-137319401 ATGTGTTAGATGAAAGAAAGGGG - Intronic
998167049 5:139850103-139850125 ATGGGTGGTAGGAAGGGGAGAGG - Intronic
998713213 5:144849792-144849814 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
998721614 5:144958049-144958071 ATGTGTCAGATTAAGGGAAGAGG + Intergenic
998782554 5:145674302-145674324 ATGGGGTAGAGGGAGGGGGGAGG - Intronic
998953237 5:147412945-147412967 GTGTGCTAGAGGCAGAGGAGAGG - Intronic
999205498 5:149845128-149845150 TGTTGTCAGAGGAAGGGGAGTGG + Intronic
999257160 5:150216121-150216143 AGGACTTAGAGGCAGGGGAGGGG + Intronic
999513321 5:152275782-152275804 ATGTCTTTGAGGAAGGGGCAAGG - Intergenic
999518126 5:152321349-152321371 GTGGGGTGGAGGAAGGGGAGAGG + Intergenic
999652670 5:153782972-153782994 AGGTGGTAGTGGAAAGGGAGAGG + Intronic
999991911 5:157057815-157057837 ATGGGGTAGGGGAAGGGGAGGGG - Intronic
1000608001 5:163344762-163344784 AGGTGTTAGAGGCATGGGGGTGG - Intergenic
1003335851 6:5171502-5171524 GTGTGTTAGGGGAAGTGGTGGGG + Intronic
1004179846 6:13371723-13371745 TGGTGGTAGAGGAACGGGAGGGG + Intronic
1004239798 6:13910269-13910291 GTGTGGTAGAGGGTGGGGAGAGG + Intergenic
1004447040 6:15710105-15710127 AAGGGGAAGAGGAAGGGGAGGGG - Intergenic
1004818357 6:19337087-19337109 AAGAGAGAGAGGAAGGGGAGAGG + Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006031590 6:31180390-31180412 ATGGCTCAGGGGAAGGGGAGAGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006926121 6:37656046-37656068 ACCTGTTAGAGGCAGGGGATAGG + Intronic
1007278571 6:40693373-40693395 ATGTGATAGAGACATGGGAGAGG - Intergenic
1007278708 6:40694395-40694417 ATGTGATAGAGACATGGGAGAGG - Intergenic
1007346048 6:41229971-41229993 AAGTGTGAGAGGAAGGGGAGAGG - Intronic
1007838482 6:44696527-44696549 ATGTGTGTGAGGATGGAGAGAGG + Intergenic
1008860110 6:56138831-56138853 ATGTGGTAGAGGAAGTGGGGAGG + Intronic
1009051730 6:58283735-58283757 AAGGCTTGGAGGAAGGGGAGGGG + Intergenic
1009385313 6:63079712-63079734 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1011374411 6:86674291-86674313 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1011813904 6:91165994-91166016 CTGTGGTAGAGCAAGGGGAGTGG + Intergenic
1012609191 6:101194445-101194467 ATGTGGTCGGGGAAGGGGGGAGG + Intergenic
1014061962 6:117082029-117082051 ATGGGGTAGGGGAAGGGGAGAGG + Intergenic
1015189258 6:130455452-130455474 ATGTGTAAGATGAAGTGGTGGGG + Intergenic
1015217685 6:130768723-130768745 ATGTGAAAGATGAAGGGGAATGG - Intergenic
1015541326 6:134317207-134317229 ATTTGTTGGAGGAGGGGCAGGGG - Intronic
1017101605 6:150854116-150854138 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
1017410734 6:154165300-154165322 TTGTCTTTGAGGAAGAGGAGAGG - Intronic
1017571118 6:155745440-155745462 ATGTGGTAGGGGGAGGGGAGTGG + Intergenic
1019590224 7:1827176-1827198 ATGAGTTAGAGGAGGTGGCGGGG + Intronic
1020082528 7:5294528-5294550 ATGTGTTACGGGGTGGGGAGAGG - Intronic
1020208560 7:6139800-6139822 CTGTGTGGGAGGAAAGGGAGCGG - Intronic
1021367220 7:19794935-19794957 TTGTGTTAGTGGACTGGGAGAGG + Intergenic
1021688843 7:23213055-23213077 ATGAGGAAGAGGAGGGGGAGGGG + Intergenic
1022945636 7:35281011-35281033 ATGTTCTTGAGGAAGTGGAGGGG + Intergenic
1023082013 7:36534550-36534572 ATGGTTTCGAGGAAGGGAAGAGG + Intronic
1024244759 7:47460711-47460733 ATGTGTTAAATAAAAGGGAGAGG + Intronic
1024263144 7:47586886-47586908 ATGTGTTAGGGGTAGTGAAGGGG - Intergenic
1024363194 7:48491118-48491140 ATGTTTTCAAGGAAGGGGCGAGG + Intronic
1024471563 7:49772688-49772710 ATGTGTTGGAGGGGGTGGAGGGG + Intergenic
1024666360 7:51550955-51550977 CAGAGTGAGAGGAAGGGGAGAGG + Intergenic
1024740435 7:52348137-52348159 ATATTTTAGAAGATGGGGAGAGG + Intergenic
1025798211 7:64759419-64759441 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1026047841 7:66919999-66920021 AAGTGTTAGGGGAATGGGATGGG - Intergenic
1027791682 7:82643548-82643570 AGGAGGTAGTGGAAGGGGAGGGG - Intergenic
1028494595 7:91449269-91449291 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1029472288 7:100762197-100762219 ATGTGCTAGGGGAACAGGAGAGG - Exonic
1029833869 7:103289209-103289231 ATGAGTTAGAGGAGGGAAAGAGG + Intergenic
1031462834 7:122072810-122072832 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
1031539997 7:122983388-122983410 TTGTTTTAGATGAAAGGGAGAGG - Intergenic
1031980139 7:128119407-128119429 ATATGGTTGAGGAAGGGGTGAGG - Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032265918 7:130369909-130369931 ATTTGGTAGAAGAAGGGGATGGG + Intergenic
1032756055 7:134891768-134891790 ATGTGGGAGTGGGAGGGGAGAGG + Intronic
1032792205 7:135250591-135250613 GTGTGTTGCAGGAAGGGAAGAGG + Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033370673 7:140704589-140704611 CTGTGATAGAGGGAGGGTAGGGG - Intronic
1033377940 7:140782051-140782073 ATGGGGTAGGGGGAGGGGAGAGG - Intronic
1033712386 7:143961047-143961069 ATGTTATGGAGGAGGGGGAGTGG + Intergenic
1034527724 7:151676231-151676253 ATGTATCTGAGGAGGGGGAGGGG + Intronic
1034549795 7:151813235-151813257 AGGTGTTGGAAGATGGGGAGAGG - Intronic
1034822530 7:154230161-154230183 CTGTGTGGGAGGATGGGGAGAGG - Intronic
1035647831 8:1242234-1242256 ATGTGTTTGTGGAAGAGGGGAGG + Intergenic
1035975606 8:4307340-4307362 ATGAGTCAGAGCAATGGGAGAGG + Intronic
1036432661 8:8704420-8704442 ATGTGTTCCATGAAGGGGACTGG + Intergenic
1036597796 8:10229829-10229851 ATTTGGAAGAGGAAAGGGAGAGG + Intronic
1037154561 8:15684353-15684375 ATGCAGTAGAGGAAGGGCAGAGG + Intronic
1037658810 8:20909847-20909869 AGCTGTTAAAGGAAAGGGAGGGG + Intergenic
1038037645 8:23700082-23700104 CTGTGTTAGAAGAGGGTGAGAGG + Intergenic
1038285910 8:26206449-26206471 ATGTTTTGGAAGAAAGGGAGTGG - Intergenic
1039233307 8:35473227-35473249 ATGTCCCAGAGGATGGGGAGGGG + Intronic
1039827460 8:41187134-41187156 GGGTTTTCGAGGAAGGGGAGAGG + Intergenic
1040796200 8:51292191-51292213 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1040853181 8:51923205-51923227 AAGTCTTAGGGGAAGGGGAGGGG - Intergenic
1041002558 8:53466657-53466679 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
1041305127 8:56449678-56449700 TTGGGTGACAGGAAGGGGAGGGG - Intergenic
1041866002 8:62574005-62574027 AGGGGTTGGAGGAAGTGGAGAGG - Intronic
1042404399 8:68387121-68387143 ATGTGTGGGAGGAAGGTGAAAGG + Intronic
1042614613 8:70634642-70634664 ATGTGCTAGAGTAAAGGAAGAGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1042841064 8:73124347-73124369 TTGTGTTAGTGGATGGGGAAAGG - Intergenic
1043166974 8:76915348-76915370 ATGTGCTCCAGGAAGGAGAGTGG - Intergenic
1043242960 8:77959561-77959583 ATGAGATAGAAAAAGGGGAGGGG - Intergenic
1043531956 8:81161040-81161062 ATGTGTGAGAGAAAGGGCATTGG + Intergenic
1043915529 8:85918429-85918451 ATGGGGTAGGGGGAGGGGAGAGG + Intergenic
1044074951 8:87809095-87809117 ATGTGTTAGAGGCAGCACAGAGG + Intergenic
1046218346 8:111179830-111179852 ATGGGGTAGGGGAAGGGGGGAGG - Intergenic
1046303956 8:112337280-112337302 ATGTGTGTGGGGAAGGGAAGGGG - Intronic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1046942189 8:119942046-119942068 ATATGTTACAGCAGGGGGAGGGG - Intronic
1047455113 8:125001101-125001123 ATGGGTTTGAGGAATGGGAAAGG + Intronic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048033086 8:130651421-130651443 ATGGGTCAGAGGCAGGGCAGGGG + Intergenic
1049006133 8:139856754-139856776 AAGTGTTGAAGGAAGGGGAGGGG + Intronic
1049827481 8:144678851-144678873 ATGTGGCAGAGACAGGGGAGTGG + Intergenic
1050237397 9:3596378-3596400 ATGTGTTAGCTGAGGGTGAGTGG + Intergenic
1050418470 9:5438085-5438107 ATGAGGCAGAGGAAGCGGAGTGG + Intergenic
1050531812 9:6597203-6597225 AGGGGCTATAGGAAGGGGAGAGG + Intronic
1051250716 9:15156189-15156211 GAGCTTTAGAGGAAGGGGAGAGG - Intergenic
1051736779 9:20208313-20208335 AAGGGCTAGAGGAATGGGAGAGG + Intergenic
1052642970 9:31193012-31193034 ATGTGGTAGAATAAGGGGAATGG - Intergenic
1056052357 9:82782581-82782603 GTAGGTTAAAGGAAGGGGAGAGG + Intergenic
1056068388 9:82960718-82960740 ATGGCTTAGAAGAAGGGGCGGGG + Intergenic
1056133138 9:83604962-83604984 ATCTGTTAGATCAAGGGGAGAGG - Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056392141 9:86150208-86150230 AGGAGCTAGTGGAAGGGGAGGGG + Intergenic
1056442413 9:86634108-86634130 GTGTGTGAGAAGAAGGGGTGTGG + Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056729222 9:89150355-89150377 GTGTGGGAGAGGATGGGGAGTGG - Intronic
1056932195 9:90888540-90888562 CTATGTTAGAGAAAGGAGAGCGG + Exonic
1057461021 9:95262004-95262026 ATGTGTGAGAAGAAGGGCAATGG - Intronic
1057767427 9:97934423-97934445 ATGGGGGAGAGGAGGGGGAGGGG + Intronic
1058902616 9:109455667-109455689 AAGTTTTAGAAGAGGGGGAGGGG - Intronic
1059760102 9:117329556-117329578 GGGTTTTAGAGGAAGGGGAGAGG + Intronic
1059794471 9:117677340-117677362 ATTTGGAAGAGGAAGGGGTGGGG + Intergenic
1060120912 9:120988524-120988546 GTGTGTTTGAGGAAGGCTAGTGG + Intronic
1060690749 9:125657284-125657306 ATATATGAGAGAAAGGGGAGGGG - Intronic
1060855273 9:126910059-126910081 ATGTGTAACAGGATGTGGAGAGG - Intergenic
1061487128 9:130925616-130925638 CTGTGTTGGAGGGAGGGGCGGGG - Intronic
1061488225 9:130931047-130931069 AAGAGATAGAGGAAGGAGAGAGG - Intronic
1061661628 9:132134055-132134077 GTGTGTTAGTGGGAGGGAAGAGG - Intergenic
1062316673 9:135970696-135970718 AGGTGATGGGGGAAGGGGAGAGG - Intergenic
1062333690 9:136055736-136055758 ACGTGGTAGAGGAAGGAGAGAGG + Intronic
1062533471 9:137011615-137011637 ATGGGTAAGCGGAAGCGGAGGGG - Exonic
1185930215 X:4194466-4194488 ATTTGCTAGAGAAAGGAGAGTGG - Intergenic
1185942804 X:4340445-4340467 ATGTGTTAGTGAAATGGGAAAGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186596690 X:10989369-10989391 CTGTCATAAAGGAAGGGGAGGGG + Intergenic
1187268169 X:17756366-17756388 CTCTGTTAGAGCAGGGGGAGTGG - Intergenic
1187321069 X:18237907-18237929 CTCTGTTAGAGCAGGGGGAGTGG + Intergenic
1187430294 X:19217339-19217361 ATGTGTTCCAGCAAAGGGAGGGG - Intergenic
1187596425 X:20777552-20777574 ATGGGGTAGGGGAAGGGGGGCGG + Intergenic
1191772896 X:64781957-64781979 CATTGTTAGAGGATGGGGAGGGG + Intergenic
1191864151 X:65690421-65690443 AAGTGCTGGAGGAAGGGGTGGGG + Intronic
1191966927 X:66768904-66768926 CTGTGGTGGAGGATGGGGAGAGG - Intergenic
1192049780 X:67713791-67713813 ATTTGTTAATGTAAGGGGAGGGG - Intronic
1192180761 X:68914357-68914379 ATGTGTGTGGGGGAGGGGAGCGG - Intergenic
1194023331 X:88721266-88721288 TTGTGTCAGAGGACTGGGAGAGG - Intergenic
1194706960 X:97187229-97187251 ATGTATTAGAGGAAGGAGTAGGG + Intronic
1195038931 X:100995932-100995954 ATGTGTTGGAGTAGGGGGTGTGG - Intergenic
1195516177 X:105778804-105778826 ATGTGTATGGGGGAGGGGAGTGG - Intergenic
1195664949 X:107420666-107420688 ATGTGTTAATGGATGGAGAGTGG - Intergenic
1195855662 X:109329957-109329979 ATGGGGTTGGGGAAGGGGAGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196053092 X:111326151-111326173 ATGAGTTGGGGGAAGGGGAATGG + Intronic
1196739275 X:119010179-119010201 ATGTGAGAGGTGAAGGGGAGGGG + Intronic
1196892579 X:120305678-120305700 AGGGGATAGAGGGAGGGGAGAGG + Intronic
1197063081 X:122205346-122205368 ATTTGTGATAGGAAGGTGAGGGG - Intergenic
1197902511 X:131389361-131389383 GTGAGTTAGAGGAAGAGGATAGG + Intronic
1198594366 X:138220291-138220313 ATGTCTTAGAGCAAGATGAGGGG - Intergenic
1198655305 X:138907340-138907362 ATCTGTTAGGGAGAGGGGAGGGG - Intronic
1199585858 X:149415180-149415202 TTGTGTTCGAGGAAGGAGATAGG + Intergenic
1199616082 X:149657293-149657315 ATGTTCTAGCGGGAGGGGAGGGG - Intergenic
1199626558 X:149745955-149745977 ATGTTCTAGCGGGAGGGGAGGGG + Intergenic
1199721189 X:150543717-150543739 ATTTGTTAAATGAAGGGGAGTGG - Intergenic
1201404353 Y:13635004-13635026 AGGAGCTAGTGGAAGGGGAGGGG - Intergenic
1201531090 Y:14990394-14990416 AGGAGGTAGTGGAAGGGGAGAGG - Intergenic
1201727729 Y:17172210-17172232 ATGTGTTAGTGAAATGGGAAAGG + Intergenic
1201898776 Y:19024453-19024475 ATTTGGTAATGGAAGGGGAGGGG + Intergenic
1202046928 Y:20744767-20744789 AGGTGTGTGAGGAACGGGAGAGG - Intergenic