ID: 936090070

View in Genome Browser
Species Human (GRCh38)
Location 2:109495835-109495857
Sequence GGGGATAATAATACATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936090059_936090070 28 Left 936090059 2:109495784-109495806 CCTGGCCCCCTTTCTTCATTTTT 0: 1
1: 3
2: 27
3: 261
4: 2097
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162
936090064_936090070 0 Left 936090064 2:109495812-109495834 CCTAGTTTCCACATACATAAAAT 0: 1
1: 0
2: 22
3: 140
4: 888
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162
936090068_936090070 -8 Left 936090068 2:109495820-109495842 CCACATACATAAAATGGGGATAA 0: 2
1: 22
2: 223
3: 1380
4: 4368
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162
936090062_936090070 21 Left 936090062 2:109495791-109495813 CCCTTTCTTCATTTTTATAGTCC 0: 1
1: 0
2: 3
3: 65
4: 642
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162
936090061_936090070 22 Left 936090061 2:109495790-109495812 CCCCTTTCTTCATTTTTATAGTC 0: 1
1: 1
2: 3
3: 79
4: 760
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162
936090060_936090070 23 Left 936090060 2:109495789-109495811 CCCCCTTTCTTCATTTTTATAGT 0: 1
1: 0
2: 11
3: 75
4: 914
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162
936090063_936090070 20 Left 936090063 2:109495792-109495814 CCTTTCTTCATTTTTATAGTCCT 0: 1
1: 0
2: 5
3: 61
4: 601
Right 936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936090070 Original CRISPR GGGGATAATAATACATGTCT GGG Intronic
900377549 1:2363372-2363394 GGGGATCATCATAAATGTATTGG - Intronic
905721054 1:40202064-40202086 GGGGATAATAATACTTGCCTTGG + Intronic
907366049 1:53961107-53961129 GAGGATAATAATGAATGTCCTGG + Intronic
908344610 1:63219224-63219246 GGGAATATGAATACATGACTTGG + Intergenic
908995321 1:70145758-70145780 AGGGTTAATAATACATGACAAGG + Exonic
910626678 1:89314746-89314768 GAGGATAAAAACTCATGTCTAGG - Intergenic
911506248 1:98756253-98756275 AGGGCTTATAATACATGTATAGG - Intronic
912974499 1:114315647-114315669 GGGGATAATAATGCTTTTCTAGG - Intergenic
916503841 1:165409755-165409777 TGGGATAATAGTACATGCCTTGG - Intronic
921029550 1:211325709-211325731 GGGGAGAATAATACACACCTTGG - Intergenic
921278093 1:213538947-213538969 GGGGATAATAATATCTGTCCTGG - Intergenic
921569224 1:216758928-216758950 GGGGATAATAATACCTTCTTAGG - Intronic
921812948 1:219535258-219535280 GTGGATAATAAATCAAGTCTAGG - Intergenic
923359735 1:233199140-233199162 GGGGTAAATAATACATCTATGGG + Intronic
1068020130 10:51571370-51571392 AGAAATAATAATACTTGTCTTGG + Intronic
1069743701 10:70701593-70701615 GGGGATAATAACACATTTTCTGG + Intronic
1070562553 10:77578791-77578813 GGGGATGAGAGTCCATGTCTTGG - Intronic
1071412707 10:85412677-85412699 GAAGATATTAATACATGTCCAGG + Intergenic
1075185745 10:120255301-120255323 GGGAATACTAATTAATGTCTGGG - Intergenic
1080329521 11:31119447-31119469 GGGGTTATAAATACATGTTTAGG + Intronic
1081260682 11:40956537-40956559 GGGGATAATATTACCTTTCTAGG + Intronic
1081920038 11:46766534-46766556 GGGTGTAATAATACATGTACTGG + Intronic
1083200802 11:61119887-61119909 GGGGAGAAAAAAAAATGTCTAGG + Intronic
1083429443 11:62606350-62606372 GGGGAGAATAACAGATGTGTTGG - Intronic
1086383059 11:86278968-86278990 AGGGATAATAATACTTGCCTTGG + Intergenic
1086827275 11:91514957-91514979 AGGCATAATAATACACTTCTTGG + Intergenic
1088463333 11:110106555-110106577 GGTGATAATAATACATATCGTGG + Intronic
1090630292 11:128640703-128640725 GAGGAAAATGATACATTTCTGGG + Intergenic
1090741446 11:129664997-129665019 GGGGAAAATAATACAAATTTAGG - Intergenic
1090960048 11:131548100-131548122 AGGGATAATAATACTTCTCTGGG + Intronic
1091947062 12:4556105-4556127 GGGGATAGTAATATCTGTATTGG + Intronic
1092563291 12:9638666-9638688 GAGGATACAAATACATGTCTGGG - Intergenic
1094531845 12:31283300-31283322 GTAGATAAAAATACATGTGTGGG + Intronic
1095407364 12:41881565-41881587 GGAGATAATAATACCTGCCTTGG - Intergenic
1102195584 12:111022947-111022969 GGGGATAATAATAAAAGTGCTGG + Intergenic
1105910413 13:24859884-24859906 GGGAATAATAATCTATGTCTAGG - Intronic
1106962939 13:35022639-35022661 GGAGATAAATATATATGTCTTGG + Intronic
1112309637 13:98306965-98306987 GGGGACAATAATAGGTTTCTGGG - Intronic
1112386872 13:98947846-98947868 TGGGATATTAGTTCATGTCTAGG - Intronic
1113079034 13:106497360-106497382 TGCCATAATAATACTTGTCTTGG + Intronic
1113214517 13:108023217-108023239 GGGGATATTTATGAATGTCTTGG - Intergenic
1113596084 13:111534360-111534382 GGGGATAATAATAAATGTTACGG + Intergenic
1115447364 14:33506756-33506778 GGGAATAAAAATTCAGGTCTAGG + Intronic
1115478518 14:33839416-33839438 GGGGATAACATTACCTGCCTGGG - Intergenic
1116780273 14:49229141-49229163 GGAGATTGTAATTCATGTCTGGG - Intergenic
1117719307 14:58613379-58613401 GGTGATAATAATACAGGTTTTGG - Intergenic
1118302380 14:64627081-64627103 GGGCACAATAATAGATGTTTGGG + Intergenic
1119044754 14:71308780-71308802 GCAGACAATAATAAATGTCTAGG - Intergenic
1120265920 14:82251133-82251155 GTAGATAATAATACCAGTCTTGG + Intergenic
1120273664 14:82345988-82346010 GGTGCTAATAATACTGGTCTGGG + Intergenic
1120293996 14:82615616-82615638 AGGGAAAATAATACATTTATAGG - Intergenic
1121233717 14:92377223-92377245 AGGGAGAATTATACATGTCAAGG + Intronic
1121262524 14:92576725-92576747 GGGGATAATAATAAAACTCATGG + Intronic
1123797872 15:23791921-23791943 GGGGATTAAATTACATATCTAGG + Intergenic
1131045326 15:89310450-89310472 GGGGAAAATAATAGCAGTCTAGG - Intronic
1134195802 16:12157971-12157993 GTGAATTATAATACAAGTCTGGG - Intronic
1135496409 16:22955468-22955490 GAGGATAATAATACCTTCCTCGG - Intergenic
1139283777 16:65792488-65792510 GTGGATAAACATACATGTTTTGG - Intergenic
1139704999 16:68735222-68735244 GGGAATAATAATACAGCTCTTGG + Intergenic
1141043325 16:80691011-80691033 GGGTTTACTAGTACATGTCTTGG + Intronic
1141827659 16:86492505-86492527 GGGGATAATACCACCTGCCTTGG + Intergenic
1141922987 16:87148454-87148476 GGGGATAAAAATCCAAGGCTTGG + Intronic
1142495471 17:304280-304302 GGGAATAATAATACCTATCTCGG - Intronic
1144507155 17:15841933-15841955 GGGGATAAAAACACATCTTTGGG - Intergenic
1145171281 17:20659535-20659557 GGGGATAAAAACACATCTTTGGG - Intergenic
1146181512 17:30701261-30701283 GGGGATGATGAAAAATGTCTTGG - Intergenic
1147767746 17:42848229-42848251 AGGGATAATGATATTTGTCTTGG - Intronic
1149011101 17:51857237-51857259 CGGGATAATAATACATATTTAGG - Intronic
1150370419 17:64632639-64632661 GGGGAAAATGAGACAAGTCTTGG + Intronic
1150986052 17:70198218-70198240 GGGGTTGATAAAACTTGTCTTGG - Intergenic
1153545686 18:6202989-6203011 GGTGATTTTAATACATGCCTGGG - Intronic
1156702031 18:39837161-39837183 TGATATAAAAATACATGTCTTGG - Intergenic
1159250400 18:65868323-65868345 GGGCATAGTAATACTTGCCTAGG - Intronic
1161480313 19:4507074-4507096 GGGGACACTAGTCCATGTCTGGG - Intronic
1162663783 19:12192949-12192971 TGAGATAATAACACATGTCAAGG + Intergenic
1163532148 19:17856342-17856364 GTGGATTGGAATACATGTCTGGG - Intergenic
1164623310 19:29710597-29710619 GGGGACAAAAAGACATATCTAGG - Intronic
926159827 2:10479638-10479660 GGGGATCATGATACATGACAGGG - Intergenic
927051072 2:19329859-19329881 AGAAATAATAATACCTGTCTTGG - Intergenic
927436218 2:23068805-23068827 CAGGATAATAATACAGTTCTTGG - Intergenic
928200264 2:29243379-29243401 GGGGATAATAATACCTACCTTGG + Intronic
928222385 2:29415273-29415295 GAGGATAATAATACTTCTTTTGG - Intronic
929599081 2:43193956-43193978 GAGGATAATTATTCGTGTCTTGG - Intergenic
930831177 2:55744852-55744874 GGGGATAATAATATTGGACTTGG - Intergenic
931464260 2:62473086-62473108 GGGGATAGTAAATCATCTCTAGG - Intergenic
933384180 2:81589252-81589274 GGGGATAATGATACCTTTGTGGG + Intergenic
933392845 2:81694064-81694086 GGGGATCATGAAACATGGCTTGG - Intergenic
935098974 2:99974165-99974187 GGGGAAAATAAAACAAGCCTTGG - Intronic
935573916 2:104689559-104689581 GGGAATAGTCATACCTGTCTAGG - Intergenic
936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG + Intronic
937858231 2:126688014-126688036 GGGGAAAATAACACTTTTCTGGG + Intronic
939775131 2:146376766-146376788 GGTGATCATAATACGTGTTTGGG - Intergenic
940936430 2:159500622-159500644 GGTGATATTAAGACATGTTTAGG - Intronic
942065985 2:172271857-172271879 TGGAATAATAATACATGTGCAGG + Intergenic
942287435 2:174434491-174434513 GGAGATAATAATACATATGGAGG + Exonic
944752633 2:202726732-202726754 GGGAATAATAATACCTGTCTCGG + Intronic
944792680 2:203148355-203148377 GTGGTTAAAAATACATGCCTTGG - Intronic
944901007 2:204216096-204216118 GTGGATAATCATAGAGGTCTTGG - Intergenic
944922903 2:204434103-204434125 GGGGATGTTAAAAAATGTCTTGG + Intergenic
945165114 2:206935073-206935095 AGGGATAATCCTACATGGCTAGG - Intergenic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
946949924 2:224862967-224862989 GTAGAAAATAATCCATGTCTTGG + Intronic
1169501551 20:6165617-6165639 ATGGATAATAATACAAGTCCTGG - Intergenic
1169866824 20:10210128-10210150 GGGGTTAAAAATACATTTCAAGG + Intergenic
1171334245 20:24369342-24369364 GGAGATAATTCAACATGTCTAGG + Intergenic
1174777675 20:53360688-53360710 GGGGATAATGCTACATTTTTGGG - Intronic
1175493349 20:59394159-59394181 GGGGATAACAATAAATACCTCGG + Intergenic
1176082088 20:63278596-63278618 GGGGATAAAAATTCATTTATAGG - Intronic
1177269273 21:18824869-18824891 GGGGAGAATAAATAATGTCTAGG + Intergenic
1181515517 22:23409395-23409417 GGAGATAATAATTAATGCCTTGG - Intergenic
1181585476 22:23850610-23850632 AAGGATAATAATTAATGTCTGGG + Intergenic
1182999344 22:34842251-34842273 GTGGATAATCGTAAATGTCTCGG + Intergenic
949273044 3:2243121-2243143 GAGGATAATAATACATTCCATGG - Intronic
949481063 3:4493992-4494014 TGGGAGAATAATGCATGTGTAGG + Intronic
950827879 3:15844673-15844695 GGAGATTATTTTACATGTCTTGG - Intronic
953235821 3:41105096-41105118 GTGGATAATAATACCATTCTTGG - Intergenic
959141616 3:102492701-102492723 GGGGATAATAATAATTATCTTGG + Intergenic
962654522 3:137529816-137529838 ATGGTTAATAATACATGACTGGG + Intergenic
966053606 3:175653534-175653556 GGGCTTACAAATACATGTCTTGG - Intronic
966109426 3:176380678-176380700 GGGTATAATAATAAATATCTTGG + Intergenic
967358325 3:188599160-188599182 GGAAATAATTATACATGGCTGGG + Intronic
968347529 3:198023024-198023046 GGGGAAAATTATAAATATCTGGG + Intronic
970905568 4:21212299-21212321 GGTAATAATAATACAGCTCTAGG - Intronic
973020304 4:45197128-45197150 GGAAATAGTAAAACATGTCTTGG + Intergenic
975893016 4:79051622-79051644 GGGGAAAATTATAAATGTTTAGG + Intergenic
977246966 4:94643961-94643983 AGGGCTAATAATACATTTCCAGG - Intronic
978104376 4:104883806-104883828 AGGGGTAATAATACTTATCTTGG - Intergenic
979541809 4:121892232-121892254 GTGGATTATACTATATGTCTTGG - Intronic
980797500 4:137703380-137703402 GCTGATAATTATACTTGTCTGGG + Intergenic
981492139 4:145350866-145350888 GGAGTTAATAATACCTGCCTTGG + Intergenic
981916054 4:150034456-150034478 GGGGATAATAATACAAGACCTGG + Intergenic
982347130 4:154372036-154372058 ATGGATAATAATAAATGGCTTGG + Intronic
989015257 5:36923747-36923769 GGGGATAATAATAAGTGTTAAGG + Intronic
989451981 5:41597364-41597386 GGGGATACCAGTGCATGTCTTGG + Intergenic
994676431 5:102828587-102828609 GGGGCTAATAATACACATCTAGG + Intronic
996339077 5:122416218-122416240 GGGAATAATAAAACATGAATCGG + Intronic
996672092 5:126129684-126129706 GTGAATAGTAATACAGGTCTTGG - Intergenic
998439039 5:142140852-142140874 GGGGAGAAGAATATATGTATAGG - Intronic
998822915 5:146073049-146073071 GGGGACAATAATACAACTCATGG - Intronic
999103966 5:149052670-149052692 GGGGACAATTATACATTTCAGGG - Intronic
1003785594 6:9482759-9482781 GGGGAAAACTATACATGTTTTGG + Intergenic
1005503285 6:26448661-26448683 GGGGATAAGAAGACATGCCTGGG - Intronic
1006681373 6:35798933-35798955 GGGGGTCATATTACATGGCTGGG - Intergenic
1007894651 6:45341109-45341131 GGGGTGAATAGTACATGTCAAGG - Intronic
1008564938 6:52758235-52758257 TGTGGTAATAATACATGTATAGG + Intronic
1008577032 6:52870625-52870647 TGTGGTAATAATACATGTATAGG + Intronic
1010418679 6:75645691-75645713 GGAGAAAATAATATATGGCTAGG + Intronic
1011653745 6:89531014-89531036 GGGGATAATAATGCCTGCCTCGG - Intronic
1011827493 6:91327255-91327277 GCAGATAATAATACCTGGCTTGG - Intergenic
1017442898 6:154480268-154480290 GGGCATAATAATACATCACATGG - Intronic
1021241928 7:18212894-18212916 AGGGATAAAAATAGATTTCTGGG + Intronic
1022550300 7:31232421-31232443 GGGGATAATTAGACCTTTCTTGG + Intergenic
1023904762 7:44514114-44514136 AAGGATAATAATACCTGCCTCGG + Intronic
1025758784 7:64370999-64371021 GGGGATAGTAACATATGGCTGGG + Intergenic
1027611921 7:80372050-80372072 AGGGATAATGATATATTTCTTGG + Intronic
1028969009 7:96835988-96836010 GGGCTTAATAGTACATGTTTTGG + Intergenic
1031301096 7:120061387-120061409 GTGGAAAATAATACATTTCCAGG - Intergenic
1031376017 7:121026693-121026715 GGTGATACTAATACATGGCTAGG + Intronic
1033697287 7:143802098-143802120 GAGGATGAAAATACATGTCAAGG + Intergenic
1036065103 8:5371230-5371252 GGAGATAAAAATACAGGGCTGGG - Intergenic
1037060582 8:14504448-14504470 GGTGATACTAATGCATATCTAGG - Intronic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1039707906 8:40026120-40026142 CTGGATAAGAAGACATGTCTAGG + Intergenic
1040710494 8:50182927-50182949 GGGGAGAATAATATATTTATTGG - Intronic
1041489811 8:58421228-58421250 GGGGATGAGAAAACATGTGTAGG - Intronic
1043528965 8:81128935-81128957 GGGGAGAAGAATACATGAATGGG - Intergenic
1043540715 8:81259129-81259151 GAGGATAATAATACATACATAGG + Intergenic
1046677754 8:117130418-117130440 GGGGATCATAATTCATCTTTGGG - Intronic
1047093493 8:121598673-121598695 TGGGATCATAATTCATCTCTTGG + Intergenic
1047290694 8:123527257-123527279 GGAGAAAATAATACAGGTTTTGG + Intronic
1049082150 8:140451818-140451840 GGTGATAATAGAACTTGTCTTGG + Intronic
1050037131 9:1448614-1448636 GGGCCAAATAAAACATGTCTGGG + Intergenic
1050069136 9:1792037-1792059 AGGGATAATAGTACTTGTGTAGG - Intergenic
1052033844 9:23658037-23658059 GGGGATAACAATACCTAGCTTGG - Intergenic
1052101976 9:24458871-24458893 AAGGATAATAATACCTATCTAGG + Intergenic
1056076323 9:83044587-83044609 GGGGAATATAATATATGTATAGG + Intronic
1059862329 9:118478634-118478656 GGGGCTAATTATAGATCTCTGGG - Intergenic
1061019227 9:128003321-128003343 GGGGATACTAGTACTTATCTGGG + Intergenic
1186704356 X:12126334-12126356 GAGGAGAATACTACATTTCTTGG + Intergenic
1186777572 X:12880924-12880946 GGAGATAATAATAGAGGTCTAGG + Intronic
1189194098 X:39137772-39137794 AGGGAAAATAATATTTGTCTTGG - Intergenic
1190995971 X:55609524-55609546 GGGGATCATAAGACATGATTGGG + Intergenic
1192603862 X:72493159-72493181 GGGAATAATGAGACATGTCTGGG + Intronic
1193636870 X:83961785-83961807 TGGGATAAACATACATGTGTAGG - Intergenic
1195177212 X:102322775-102322797 GGGGCTAATAATCTATCTCTTGG + Intronic
1195181652 X:102364318-102364340 GGGGCTAATAATCTATCTCTTGG - Intronic
1195521614 X:105836826-105836848 GGGGCTAATAATACCTACCTTGG + Intronic
1199761856 X:150910955-150910977 GGGGATGATAATAAAAGTTTTGG + Intergenic
1200843153 Y:7804180-7804202 GGGGATAGTAGCACATGGCTGGG - Intergenic
1202353728 Y:24023230-24023252 GGGTATCATAATACTTTTCTAGG + Intergenic
1202517051 Y:25646885-25646907 GGGTATCATAATACTTTTCTAGG - Intergenic