ID: 936090363

View in Genome Browser
Species Human (GRCh38)
Location 2:109498215-109498237
Sequence CGGGTGCACGATGGTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936090363_936090368 4 Left 936090363 2:109498215-109498237 CCAGTCCAACCATCGTGCACCCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 936090368 2:109498242-109498264 TGCTCTGAGACACTTAGAGTTGG 0: 1
1: 0
2: 2
3: 11
4: 179
936090363_936090369 8 Left 936090363 2:109498215-109498237 CCAGTCCAACCATCGTGCACCCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 936090369 2:109498246-109498268 CTGAGACACTTAGAGTTGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 120
936090363_936090371 16 Left 936090363 2:109498215-109498237 CCAGTCCAACCATCGTGCACCCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 936090371 2:109498254-109498276 CTTAGAGTTGGCTGGTATTCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
936090363_936090370 15 Left 936090363 2:109498215-109498237 CCAGTCCAACCATCGTGCACCCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 936090370 2:109498253-109498275 ACTTAGAGTTGGCTGGTATTCGG 0: 1
1: 0
2: 1
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936090363 Original CRISPR CGGGTGCACGATGGTTGGAC TGG (reversed) Intronic
908702755 1:66920097-66920119 TGGGTGCAGGATAGTGGGACAGG - Intronic
909198129 1:72652314-72652336 CTGGTGCACGATGTTGGTACTGG - Intergenic
1069314211 10:67077468-67077490 AGGGTCCAGAATGGTTGGACTGG - Intronic
1078552985 11:12293228-12293250 CGGGCCCATGATGGTAGGACTGG - Intronic
1090645772 11:128765512-128765534 AGGGGGCAGGATGGTGGGACAGG - Intronic
1098881930 12:75926202-75926224 CAGGTTCACCATGGTTGGCCAGG - Intergenic
1102270610 12:111531678-111531700 AGGGTGCAGGATGTATGGACTGG + Intronic
1104248268 12:127063618-127063640 CGTGTGCACAAGGGCTGGACAGG + Intergenic
1119774265 14:77238846-77238868 TTGGTGCAGGATGGTGGGACTGG + Intronic
1123725025 15:23093184-23093206 CTGGTGTAGGTTGGTTGGACAGG - Intergenic
1131959358 15:97772828-97772850 CTGTTGTACAATGGTTGGACTGG + Intergenic
1155056554 18:22188854-22188876 TGGGGGCAGGATGGTTGGAGTGG + Intronic
1161304316 19:3558259-3558281 TGGGAGGACGTTGGTTGGACGGG - Intronic
1161581350 19:5082712-5082734 CGGGTGGACGATGGTGGCCCAGG + Intronic
927936249 2:27078497-27078519 GTGGCGCACGATGGTTGGAGAGG + Intergenic
936090363 2:109498215-109498237 CGGGTGCACGATGGTTGGACTGG - Intronic
937045030 2:118846683-118846705 CGGGTGCCCAACGGGTGGACAGG + Exonic
942495271 2:176533561-176533583 AGGGAGCACGCTGGTTAGACAGG + Intergenic
1179158870 21:38875473-38875495 TGGGTGCATGGTGCTTGGACTGG + Intergenic
954339461 3:49941187-49941209 CTGGTGCGTGATGGTAGGACTGG + Intronic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
985966954 5:3344860-3344882 CGGGTGCACGCTGGTTAGGGAGG + Intergenic
1017765455 6:157603481-157603503 CTGGAGCACGATGCTTGAACAGG + Intronic
1035046477 7:155970953-155970975 TGGGTGCACAATGGTTCGAGGGG + Intergenic
1041673836 8:60517684-60517706 CTGGTGGAGGAAGGTTGGACTGG - Intronic
1054454332 9:65421811-65421833 TGGGTGGATGATGGATGGACGGG + Intergenic