ID: 936092086

View in Genome Browser
Species Human (GRCh38)
Location 2:109507957-109507979
Sequence GTGGGTTCACTAAGAAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936092083_936092086 -6 Left 936092083 2:109507940-109507962 CCCAAATGCCAAGAGTGGTGGGT No data
Right 936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG No data
936092076_936092086 19 Left 936092076 2:109507915-109507937 CCCACGTGGGCAAAGCCTGTCCT No data
Right 936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG No data
936092079_936092086 -1 Left 936092079 2:109507935-109507957 CCTGTCCCAAATGCCAAGAGTGG No data
Right 936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG No data
936092078_936092086 4 Left 936092078 2:109507930-109507952 CCTGTCCTGTCCCAAATGCCAAG No data
Right 936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG No data
936092084_936092086 -7 Left 936092084 2:109507941-109507963 CCAAATGCCAAGAGTGGTGGGTT No data
Right 936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG No data
936092077_936092086 18 Left 936092077 2:109507916-109507938 CCACGTGGGCAAAGCCTGTCCTG No data
Right 936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936092086 Original CRISPR GTGGGTTCACTAAGAAACGC TGG Intergenic
No off target data available for this crispr