ID: 936092820

View in Genome Browser
Species Human (GRCh38)
Location 2:109511972-109511994
Sequence GTTGCTGCCCAGAGGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936092812_936092820 26 Left 936092812 2:109511923-109511945 CCCACAGCAGGTGCCGATGCACA No data
Right 936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG No data
936092814_936092820 13 Left 936092814 2:109511936-109511958 CCGATGCACACGTACTGCAGAAT No data
Right 936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG No data
936092813_936092820 25 Left 936092813 2:109511924-109511946 CCACAGCAGGTGCCGATGCACAC No data
Right 936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936092820 Original CRISPR GTTGCTGCCCAGAGGACTCT GGG Intergenic
No off target data available for this crispr