ID: 936093699

View in Genome Browser
Species Human (GRCh38)
Location 2:109516420-109516442
Sequence CAGAAGCACGGGCCTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093694_936093699 4 Left 936093694 2:109516393-109516415 CCTGGTGCAGGAGAGGTTCCACT No data
Right 936093699 2:109516420-109516442 CAGAAGCACGGGCCTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093699 Original CRISPR CAGAAGCACGGGCCTACAGC TGG Intergenic
No off target data available for this crispr