ID: 936093731

View in Genome Browser
Species Human (GRCh38)
Location 2:109516559-109516581
Sequence GCCGCCACTGGAGGGCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093723_936093731 11 Left 936093723 2:109516525-109516547 CCTCAGGCAGGGCACAGGCAAGG No data
Right 936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG No data
936093722_936093731 15 Left 936093722 2:109516521-109516543 CCTTCCTCAGGCAGGGCACAGGC No data
Right 936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG No data
936093719_936093731 19 Left 936093719 2:109516517-109516539 CCGCCCTTCCTCAGGCAGGGCAC No data
Right 936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG No data
936093718_936093731 20 Left 936093718 2:109516516-109516538 CCCGCCCTTCCTCAGGCAGGGCA No data
Right 936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG No data
936093720_936093731 16 Left 936093720 2:109516520-109516542 CCCTTCCTCAGGCAGGGCACAGG No data
Right 936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093731 Original CRISPR GCCGCCACTGGAGGGCGTGC TGG Intergenic
No off target data available for this crispr