ID: 936093866

View in Genome Browser
Species Human (GRCh38)
Location 2:109517248-109517270
Sequence TGAAGTCATGGGCGATGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093866_936093882 29 Left 936093866 2:109517248-109517270 CCACGCCATCGCCCATGACTTCA No data
Right 936093882 2:109517300-109517322 TCTTTATCCCCGGACTGTGCGGG No data
936093866_936093881 28 Left 936093866 2:109517248-109517270 CCACGCCATCGCCCATGACTTCA No data
Right 936093881 2:109517299-109517321 CTCTTTATCCCCGGACTGTGCGG No data
936093866_936093883 30 Left 936093866 2:109517248-109517270 CCACGCCATCGCCCATGACTTCA No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093866_936093875 19 Left 936093866 2:109517248-109517270 CCACGCCATCGCCCATGACTTCA No data
Right 936093875 2:109517290-109517312 CCAGCCCCCCTCTTTATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093866 Original CRISPR TGAAGTCATGGGCGATGGCG TGG (reversed) Intergenic
No off target data available for this crispr