ID: 936093867

View in Genome Browser
Species Human (GRCh38)
Location 2:109517253-109517275
Sequence GGCACTGAAGTCATGGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093867_936093884 30 Left 936093867 2:109517253-109517275 CCATCGCCCATGACTTCAGTGCC No data
Right 936093884 2:109517306-109517328 TCCCCGGACTGTGCGGGGCCTGG No data
936093867_936093875 14 Left 936093867 2:109517253-109517275 CCATCGCCCATGACTTCAGTGCC No data
Right 936093875 2:109517290-109517312 CCAGCCCCCCTCTTTATCCCCGG No data
936093867_936093883 25 Left 936093867 2:109517253-109517275 CCATCGCCCATGACTTCAGTGCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093867_936093881 23 Left 936093867 2:109517253-109517275 CCATCGCCCATGACTTCAGTGCC No data
Right 936093881 2:109517299-109517321 CTCTTTATCCCCGGACTGTGCGG No data
936093867_936093882 24 Left 936093867 2:109517253-109517275 CCATCGCCCATGACTTCAGTGCC No data
Right 936093882 2:109517300-109517322 TCTTTATCCCCGGACTGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093867 Original CRISPR GGCACTGAAGTCATGGGCGA TGG (reversed) Intergenic
No off target data available for this crispr