ID: 936093868

View in Genome Browser
Species Human (GRCh38)
Location 2:109517259-109517281
Sequence CAAAGGGGCACTGAAGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093868_936093884 24 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093884 2:109517306-109517328 TCCCCGGACTGTGCGGGGCCTGG No data
936093868_936093875 8 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093875 2:109517290-109517312 CCAGCCCCCCTCTTTATCCCCGG No data
936093868_936093882 18 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093882 2:109517300-109517322 TCTTTATCCCCGGACTGTGCGGG No data
936093868_936093886 25 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093886 2:109517307-109517329 CCCCGGACTGTGCGGGGCCTGGG No data
936093868_936093881 17 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093881 2:109517299-109517321 CTCTTTATCCCCGGACTGTGCGG No data
936093868_936093883 19 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093868 Original CRISPR CAAAGGGGCACTGAAGTCAT GGG (reversed) Intergenic
No off target data available for this crispr