ID: 936093871

View in Genome Browser
Species Human (GRCh38)
Location 2:109517275-109517297
Sequence GGGGCTGGTGTGGAGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093871_936093883 3 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093871_936093886 9 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093886 2:109517307-109517329 CCCCGGACTGTGCGGGGCCTGGG No data
936093871_936093882 2 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093882 2:109517300-109517322 TCTTTATCCCCGGACTGTGCGGG No data
936093871_936093881 1 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093881 2:109517299-109517321 CTCTTTATCCCCGGACTGTGCGG No data
936093871_936093889 15 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093889 2:109517313-109517335 ACTGTGCGGGGCCTGGGACTTGG No data
936093871_936093884 8 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093884 2:109517306-109517328 TCCCCGGACTGTGCGGGGCCTGG No data
936093871_936093875 -8 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093875 2:109517290-109517312 CCAGCCCCCCTCTTTATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093871 Original CRISPR GGGGCTGGTGTGGAGACAAA GGG (reversed) Intergenic
No off target data available for this crispr