ID: 936093872

View in Genome Browser
Species Human (GRCh38)
Location 2:109517276-109517298
Sequence GGGGGCTGGTGTGGAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093872_936093886 8 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093886 2:109517307-109517329 CCCCGGACTGTGCGGGGCCTGGG No data
936093872_936093881 0 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093881 2:109517299-109517321 CTCTTTATCCCCGGACTGTGCGG No data
936093872_936093883 2 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093872_936093889 14 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093889 2:109517313-109517335 ACTGTGCGGGGCCTGGGACTTGG No data
936093872_936093884 7 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093884 2:109517306-109517328 TCCCCGGACTGTGCGGGGCCTGG No data
936093872_936093882 1 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093882 2:109517300-109517322 TCTTTATCCCCGGACTGTGCGGG No data
936093872_936093875 -9 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093875 2:109517290-109517312 CCAGCCCCCCTCTTTATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093872 Original CRISPR GGGGGCTGGTGTGGAGACAA AGG (reversed) Intergenic
No off target data available for this crispr