ID: 936093873

View in Genome Browser
Species Human (GRCh38)
Location 2:109517285-109517307
Sequence GATAAAGAGGGGGGCTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093873_936093889 5 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093889 2:109517313-109517335 ACTGTGCGGGGCCTGGGACTTGG No data
936093873_936093883 -7 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093873_936093884 -2 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093884 2:109517306-109517328 TCCCCGGACTGTGCGGGGCCTGG No data
936093873_936093882 -8 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093882 2:109517300-109517322 TCTTTATCCCCGGACTGTGCGGG No data
936093873_936093892 30 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093892 2:109517338-109517360 CATGCTCAATAAAGCCTGACAGG No data
936093873_936093886 -1 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093886 2:109517307-109517329 CCCCGGACTGTGCGGGGCCTGGG No data
936093873_936093881 -9 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093881 2:109517299-109517321 CTCTTTATCCCCGGACTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093873 Original CRISPR GATAAAGAGGGGGGCTGGTG TGG (reversed) Intergenic
No off target data available for this crispr