ID: 936093883

View in Genome Browser
Species Human (GRCh38)
Location 2:109517301-109517323
Sequence CTTTATCCCCGGACTGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936093871_936093883 3 Left 936093871 2:109517275-109517297 CCCTTTGTCTCCACACCAGCCCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093866_936093883 30 Left 936093866 2:109517248-109517270 CCACGCCATCGCCCATGACTTCA No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093873_936093883 -7 Left 936093873 2:109517285-109517307 CCACACCAGCCCCCCTCTTTATC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093867_936093883 25 Left 936093867 2:109517253-109517275 CCATCGCCCATGACTTCAGTGCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093869_936093883 18 Left 936093869 2:109517260-109517282 CCATGACTTCAGTGCCCCTTTGT No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093870_936093883 4 Left 936093870 2:109517274-109517296 CCCCTTTGTCTCCACACCAGCCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093872_936093883 2 Left 936093872 2:109517276-109517298 CCTTTGTCTCCACACCAGCCCCC No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data
936093868_936093883 19 Left 936093868 2:109517259-109517281 CCCATGACTTCAGTGCCCCTTTG No data
Right 936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936093883 Original CRISPR CTTTATCCCCGGACTGTGCG GGG Intergenic
No off target data available for this crispr