ID: 936095377

View in Genome Browser
Species Human (GRCh38)
Location 2:109527192-109527214
Sequence GGATGCACTTTGGCTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936095377_936095383 13 Left 936095377 2:109527192-109527214 CCCAGCTCAGCCAAAGTGCATCC No data
Right 936095383 2:109527228-109527250 CGCCTTCACTGTGCTGGTCCTGG No data
936095377_936095381 7 Left 936095377 2:109527192-109527214 CCCAGCTCAGCCAAAGTGCATCC No data
Right 936095381 2:109527222-109527244 GCCGCACGCCTTCACTGTGCTGG No data
936095377_936095385 29 Left 936095377 2:109527192-109527214 CCCAGCTCAGCCAAAGTGCATCC No data
Right 936095385 2:109527244-109527266 GTCCTGGAGACTAAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936095377 Original CRISPR GGATGCACTTTGGCTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr