ID: 936099566

View in Genome Browser
Species Human (GRCh38)
Location 2:109563364-109563386
Sequence CAGAGTAAACAAAAGAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 965
Summary {0: 1, 1: 0, 2: 2, 3: 88, 4: 874}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936099566_936099573 26 Left 936099566 2:109563364-109563386 CCCCCTTTCTTTTGTTTACTCTG 0: 1
1: 0
2: 2
3: 88
4: 874
Right 936099573 2:109563413-109563435 AACAAATGCAAACAATGCAATGG 0: 1
1: 1
2: 3
3: 48
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936099566 Original CRISPR CAGAGTAAACAAAAGAAAGG GGG (reversed) Intronic
901150756 1:7099669-7099691 CAGAGTTACCAACAGAAAGCTGG - Intronic
901315698 1:8306408-8306430 CAGAAAAAAGAAAAGAAAAGAGG + Intergenic
901587807 1:10312811-10312833 AAGAGTAAACAAAATATAGATGG - Intronic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
901725781 1:11241020-11241042 CAGATTAAAAAAAAAAAATGAGG + Intronic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
904515319 1:31050130-31050152 CAGTGTAAACAAAAGAAGTTCGG - Intronic
904650492 1:32002305-32002327 CAGAGGAAAGAACAGAAAGAGGG - Intergenic
905188823 1:36217016-36217038 AAGAGTAAACAAAACAGATGTGG - Intergenic
905587307 1:39130827-39130849 AAAAGTAAAGAAAAGAAAAGGGG - Intronic
906230664 1:44160528-44160550 AATAGTAAACAAAAGAGAGTGGG - Intergenic
906519153 1:46457098-46457120 CAGAGTAAACGGAGCAAAGGTGG + Intergenic
906937576 1:50227375-50227397 AAGAGTAACCAAGAGAAAGTGGG - Intergenic
907236297 1:53051931-53051953 ATGAGTAAACAACAGAAAGGTGG - Intergenic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
907680410 1:56557977-56557999 CAGAGTTCTCAAAAGCAAGGGGG - Intronic
908195069 1:61740252-61740274 AATAGGAAAAAAAAGAAAGGTGG - Intergenic
908565300 1:65348584-65348606 TACAGTAAGCAAAAGAAAGCAGG - Intronic
908609795 1:65845061-65845083 CAGAGTACAGAAATGACAGGTGG - Intronic
909042605 1:70671916-70671938 AAGAGTAAACAAAAGAAATTTGG - Intergenic
909184517 1:72469477-72469499 AAAAGAAAATAAAAGAAAGGAGG + Intergenic
909438792 1:75674361-75674383 CAGAGGAGACAAAAGAAAAAAGG + Intergenic
909818160 1:80023918-80023940 CAAAGTAAAAATAAAAAAGGTGG - Intergenic
909989298 1:82202744-82202766 CAGAGTAATGGAAAGAAGGGAGG + Intergenic
910039426 1:82831196-82831218 CAGAGTATGCATAAGAAAGACGG + Intergenic
910108870 1:83660531-83660553 CTGAGGAAAGAAAGGAAAGGGGG + Intergenic
910294392 1:85629536-85629558 CAGAGTTATTAAAAGAAAGGAGG + Intergenic
910377318 1:86586755-86586777 CAGAGTAAAAAAGAGAGAAGAGG + Intergenic
910720918 1:90285560-90285582 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
910826992 1:91419920-91419942 CAGAAAAAAAAAAAAAAAGGCGG - Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
911305942 1:96232587-96232609 TATAGTAAACTAAAGAAAAGTGG + Intergenic
911539172 1:99137873-99137895 CAGAGGAAACAAAGAAAAGAGGG - Intergenic
911850991 1:102820297-102820319 CAAATTAAAAAAAAAAAAGGGGG - Intergenic
913363202 1:118005057-118005079 CAGAGCAAACACAAGACAGGAGG - Intronic
913564855 1:120062909-120062931 GAGAGTAAAGCCAAGAAAGGGGG - Intronic
913633276 1:120730654-120730676 GAGAGTAAAGCCAAGAAAGGGGG + Intergenic
914000548 1:143691145-143691167 GAGAGAAAAGAAAAGAAAAGAGG + Intergenic
914285440 1:146222259-146222281 GAGAGTAAAGCCAAGAAAGGGGG - Intronic
914546471 1:148673014-148673036 GAGAGTAAAGCCAAGAAAGGGGG - Intronic
914620094 1:149397656-149397678 GAGAGTAAAGCCAAGAAAGGGGG + Intergenic
914754501 1:150554986-150555008 CAGAAAAAAAAAAAAAAAGGTGG - Intronic
914823665 1:151125090-151125112 CAGAATAAACAAAAAATATGTGG - Exonic
914874849 1:151505583-151505605 AAGAGAAAAGAAAAGAAATGTGG - Intergenic
915161199 1:153922282-153922304 GAGAGTTAAAAAAAAAAAGGGGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915784017 1:158587528-158587550 CAGGGTAAGCAAAAGAGAGTGGG + Intergenic
916522024 1:165572180-165572202 CAAAAAAAACAAAAAAAAGGAGG - Intergenic
916585303 1:166144817-166144839 CATGGTAAAGAACAGAAAGGGGG - Intronic
916941222 1:169680691-169680713 CAGAGGAAATATAACAAAGGAGG + Intronic
917129939 1:171730892-171730914 AAGAGTAAAAAAATGAAAGAAGG + Intronic
917801440 1:178574205-178574227 CAGAGTAAATGTAAGACAGGAGG - Intergenic
918224061 1:182463477-182463499 AATAGTAACCAAAAGAAAGCAGG + Intronic
918248369 1:182680379-182680401 CAGAGGAAATGAAATAAAGGAGG - Intronic
918529824 1:185506074-185506096 CACAGTAAACAAAAACAAAGTGG - Intergenic
918873503 1:190008318-190008340 AAGAAAAAACAAAAGAAAAGAGG - Intergenic
919034868 1:192293499-192293521 CAGAGTAAGAAAAAAAAAGCAGG - Intergenic
919531415 1:198725866-198725888 GGTAGAAAACAAAAGAAAGGAGG - Intronic
919709940 1:200716412-200716434 CAGATTAGCCATAAGAAAGGTGG + Intergenic
920011188 1:202868911-202868933 CAGGGAAAACAAAAAAAAGCTGG - Intergenic
920169750 1:204064396-204064418 AAGAAAAAAGAAAAGAAAGGAGG - Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
921388297 1:214593273-214593295 AACAATAAACAAAAGAAAGCTGG + Intergenic
921941801 1:220848660-220848682 CTGAGTGAAAAAAAGAAAGCTGG - Intergenic
922570304 1:226630823-226630845 AAGAGAAAAGAAAAGAAAAGAGG + Intergenic
922912326 1:229228196-229228218 TACAGTAAACAAAAGGCAGGTGG + Intergenic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
923309112 1:232718044-232718066 CAGAGGAGAACAAAGAAAGGAGG + Intergenic
923847706 1:237754934-237754956 CAGAGAAAAGAAAAAAAAAGAGG - Intronic
924471597 1:244347521-244347543 AAAAGTAAACAAAAGAATGAGGG + Intergenic
924484468 1:244467296-244467318 TAAAGTATAAAAAAGAAAGGAGG + Intronic
924675374 1:246171312-246171334 CAGAGAAATTCAAAGAAAGGAGG - Intronic
924684069 1:246269173-246269195 CAGAGAAAACAAAGGAAACTGGG - Intronic
924754621 1:246930581-246930603 CAGTTTAAAAAAAAAAAAGGGGG + Intronic
1063159786 10:3410730-3410752 CAAAGAAAAGAAAAGAAAAGAGG + Intergenic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063533783 10:6862698-6862720 AAGAGTAAAGAATGGAAAGGGGG - Intergenic
1063781667 10:9331958-9331980 AAGAGTAAACAAGAAAAAAGTGG - Intergenic
1063986159 10:11505105-11505127 TAGAGATAACAGAAGAAAGGAGG + Intronic
1064618904 10:17194033-17194055 CAAAGTAGACAAAAAAAATGGGG + Intronic
1064975880 10:21114712-21114734 CAGCGTTAATCAAAGAAAGGTGG - Intronic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065072287 10:22038252-22038274 CATACTAAAGAAAAGCAAGGAGG - Intergenic
1065283545 10:24165094-24165116 CAGAGTAAAGCAAAGAGAAGTGG + Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065651499 10:27897172-27897194 CAGAGTGAAGTAAAGAAAGAAGG - Intronic
1066223936 10:33363881-33363903 GAGAGGAAAGAAAAGAAAAGTGG + Intergenic
1066224680 10:33370600-33370622 CAGAGGAAACAAGAGAGGGGAGG - Intergenic
1067724337 10:48757435-48757457 AACAGTAATCAAAAGAAAGCTGG - Intronic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1067995131 10:51263557-51263579 CACTGTAAACAAAAACAAGGAGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068640107 10:59394722-59394744 AAGAGTAAGCAAGGGAAAGGTGG - Intergenic
1069405569 10:68094728-68094750 CAAAGAAAACAAAAAATAGGTGG + Intergenic
1070616520 10:77973578-77973600 AAAAATAAAAAAAAGAAAGGGGG + Intronic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1072068655 10:91895030-91895052 CAGATTAAACAAAGAAAATGTGG - Intergenic
1072130949 10:92493582-92493604 CAGGTTAAAAAAAAAAAAGGAGG + Intronic
1072469569 10:95699640-95699662 AAGAGAGAAGAAAAGAAAGGAGG + Intergenic
1072483896 10:95835766-95835788 CAGAGTAAACACACAAAAAGTGG - Intronic
1072525591 10:96268695-96268717 CAGAGTCATCCAAGGAAAGGAGG - Intronic
1073193758 10:101671182-101671204 CAAAGACAACAACAGAAAGGAGG + Intronic
1073866406 10:107809444-107809466 AAGAAGAAAGAAAAGAAAGGGGG + Intergenic
1074105622 10:110387883-110387905 AAGAGAAAAAAAAAGAAACGAGG + Intergenic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1075485662 10:122820195-122820217 CAGAGCATGCAAAGGAAAGGAGG - Intergenic
1075486419 10:122825424-122825446 AATACTAATCAAAAGAAAGGTGG - Intergenic
1075628162 10:123979520-123979542 AACACTAAACAAAAGAAAGCTGG + Intergenic
1075866456 10:125725144-125725166 AACAAAAAACAAAAGAAAGGTGG + Intronic
1076173546 10:128344466-128344488 AATAGTAAACAAAAGAGAGCTGG - Intergenic
1076459133 10:130627183-130627205 AAGAGTAAAGAATAGAAAAGTGG + Intergenic
1077563899 11:3284064-3284086 CAAAGTAAACAAAACAAACATGG - Intergenic
1077569789 11:3329881-3329903 CAAAGTAAACAAAACAAACATGG - Intergenic
1077818172 11:5708485-5708507 CAGAGTAGGGAAAGGAAAGGGGG - Intronic
1078332132 11:10431752-10431774 AACAGTAACCAAAAGAAAGCTGG + Intronic
1078932329 11:15921957-15921979 ATGAGGAAAGAAAAGAAAGGAGG - Intergenic
1079118647 11:17659294-17659316 CATAGTAACCAAGAGAAAGCTGG + Intergenic
1079268588 11:18959876-18959898 CAGAGTCAACAAATCACAGGTGG - Intergenic
1079379291 11:19923015-19923037 CAGAGTAAATAAAAGAAAGCAGG + Intronic
1079484571 11:20922068-20922090 TAGAGTGAACAAAAAGAAGGAGG - Intronic
1079530113 11:21442027-21442049 CAGAGTAAAGAACTCAAAGGTGG - Intronic
1079949187 11:26780675-26780697 AAGCATAAACATAAGAAAGGAGG + Intergenic
1080093908 11:28382051-28382073 CCAAATAAACAAAAGAAAGAAGG - Intergenic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1080662606 11:34309785-34309807 CAGAGTCAAAAAAAAAAAGATGG + Intronic
1080665188 11:34329729-34329751 AAGAGTAAGCAAAAGAAACAGGG + Intronic
1080938498 11:36887084-36887106 CAGAGGAAACAAATGAAATTGGG + Intergenic
1081005960 11:37740024-37740046 TAAAGCAAAAAAAAGAAAGGTGG - Intergenic
1081372207 11:42317623-42317645 CAGGGGAAAAAAAAGAAAGTAGG - Intergenic
1081907261 11:46677942-46677964 CAGAAAAAAAAAAAAAAAGGTGG + Exonic
1082218855 11:49608222-49608244 GAGAGAAAACAAAAGCAATGAGG + Intergenic
1082891024 11:58138990-58139012 TAGAGTAAGCTAAAGAAAGAGGG + Intronic
1083224259 11:61274625-61274647 CAGAGGCAGCTAAAGAAAGGGGG + Intronic
1083607768 11:63989014-63989036 CAGAAAAAAAAAAAAAAAGGTGG + Intronic
1084415479 11:69030184-69030206 GAGAGAGAAAAAAAGAAAGGAGG - Intergenic
1084423003 11:69069983-69070005 AAAAGGAAAAAAAAGAAAGGAGG - Intronic
1084766952 11:71317515-71317537 GACAGTAATCAAAAGAAAGCTGG - Intergenic
1085516272 11:77113581-77113603 GATAGAAAACAAGAGAAAGGGGG + Intronic
1085668556 11:78439455-78439477 CAGAACAAAGAAAAGAAAGGGGG + Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086036955 11:82427583-82427605 AACACTAAACAAAAGAAAGCTGG + Intergenic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086571058 11:88285130-88285152 TAGAATAAATAAAAGAAGGGTGG - Intergenic
1086743359 11:90395549-90395571 CAGAGTATACACATGAAGGGTGG - Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1086809271 11:91285520-91285542 AAGTGTAAAAAAAAGAAGGGAGG - Intergenic
1087344423 11:96952625-96952647 CAGAGAAAATATAAGAAATGCGG - Intergenic
1087406992 11:97743088-97743110 AAAAGAAAAAAAAAGAAAGGGGG - Intergenic
1087571931 11:99939250-99939272 TATAGTAAACATAATAAAGGAGG - Intronic
1087591604 11:100196120-100196142 CAGAGTAAAAAAATGAAAATGGG + Intronic
1087627471 11:100612789-100612811 GAGAGTAACGAAAAGAAAGAGGG + Intergenic
1087887721 11:103499124-103499146 CAGAGGAGACAAAAGAAAACAGG + Intergenic
1087995571 11:104803475-104803497 CAGAGAAAATAAAAGCAAGAAGG + Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1089050897 11:115544982-115545004 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1089099255 11:115947234-115947256 GAAAGGAAAGAAAAGAAAGGAGG + Intergenic
1089211523 11:116807116-116807138 AATAGTAATCAAAAGAAAGCAGG + Intergenic
1089558529 11:119330528-119330550 GAGAGAAAAAAAAAGAAAGAAGG - Intergenic
1089832400 11:121340131-121340153 CAGAGCAAAAAAGAGAAGGGAGG + Intergenic
1090106416 11:123857325-123857347 CACAGAAAAAAAAAAAAAGGGGG - Intergenic
1090134392 11:124181981-124182003 TAGAGAAAACAAAAGAAAAGAGG - Intergenic
1090167116 11:124561346-124561368 CAGAGACAGCAAGAGAAAGGGGG - Intergenic
1090186287 11:124741019-124741041 CATAGTAAAGAAAAAAAAAGTGG + Intronic
1090186519 11:124742559-124742581 TAGACTAAGCAAAAGAAATGAGG - Intronic
1090508788 11:127349216-127349238 AAGAGGAAACTAAAGAAAGAAGG + Intergenic
1090615377 11:128509494-128509516 CAAAGTAGACACATGAAAGGTGG - Intronic
1090703242 11:129314820-129314842 CAAAGAAAGCAAAAGAAAGGAGG - Intergenic
1090773233 11:129940839-129940861 AAAAGGAAACAACAGAAAGGGGG - Intronic
1090822724 11:130358424-130358446 AATAGTAATCAAAAGAAAGCTGG - Intergenic
1091525799 12:1299600-1299622 CAGAGTAAACCACAGTAAGTAGG + Intronic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1091918294 12:4284713-4284735 AAGAAAAAAAAAAAGAAAGGAGG - Intronic
1092130335 12:6107537-6107559 AACACTAACCAAAAGAAAGGTGG + Intronic
1092620210 12:10256129-10256151 AAGAGTAACCAAAAGAAATTGGG - Intergenic
1092724661 12:11473710-11473732 GAGAGCAAGCAAGAGAAAGGAGG - Intronic
1092740495 12:11624065-11624087 CAGACTAAACAAAGGGAAAGGGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093110169 12:15142447-15142469 CAGAGAGAACAAAATAAATGAGG - Intronic
1093897052 12:24585324-24585346 AAAAGTAATCAAAAGAAAGCTGG + Intergenic
1094088192 12:26617633-26617655 AAGAAAAAAGAAAAGAAAGGAGG + Intronic
1094755052 12:33458637-33458659 AATAGTAATCAAAAGAAAGCAGG + Intergenic
1094801007 12:34035996-34036018 AAGAGTAGACAAAAGAAGGCAGG - Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095384218 12:41631137-41631159 AACAGTAAACAAAACAAATGTGG + Intergenic
1095592173 12:43915698-43915720 AAGAGGAAGAAAAAGAAAGGAGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096663861 12:53149085-53149107 CAAAAAAAAAAAAAGAAAGGAGG + Intergenic
1097088036 12:56483477-56483499 CAGTGTAAAAAAAAGAAATTGGG + Intronic
1097773094 12:63612645-63612667 CAAAGTAAGCAAAAGAAATGAGG + Intronic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1097969371 12:65616110-65616132 GAGAGGAAAGGAAAGAAAGGCGG - Intergenic
1098203539 12:68082636-68082658 CAGAGTAAAAAAAACAAAGCAGG + Intergenic
1098626168 12:72672254-72672276 AAAAATAAAAAAAAGAAAGGAGG + Intergenic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1098791836 12:74834119-74834141 AAGAGAAAAAGAAAGAAAGGAGG - Intergenic
1099102661 12:78461187-78461209 CAGAATAATCAAAACAAATGGGG - Intergenic
1099204507 12:79711896-79711918 AAGAGTAAGCAATAGCAAGGTGG - Intergenic
1099634733 12:85199377-85199399 CAAAGTCAACAAAAGCAATGGGG - Intronic
1100009754 12:89939092-89939114 CATTTTAAACAAGAGAAAGGAGG - Intergenic
1100572707 12:95858337-95858359 CAGGCGAAGCAAAAGAAAGGTGG + Intergenic
1100594016 12:96056018-96056040 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1100878486 12:98989958-98989980 GAAAATAAAAAAAAGAAAGGAGG + Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101729431 12:107414698-107414720 AAAAGAAAAGAAAAGAAAGGGGG - Intronic
1102232477 12:111273127-111273149 CAGAATACACAACAGAAAGCAGG + Intronic
1102780215 12:115557790-115557812 AACAGAAAAAAAAAGAAAGGAGG + Intergenic
1102835909 12:116059843-116059865 AAGAGTAAAAAACATAAAGGAGG + Intronic
1103463237 12:121121886-121121908 CAGAGGAAACCAAGGAAAGTAGG - Intergenic
1103570389 12:121840769-121840791 CGGATTAAAAAAAAAAAAGGGGG + Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104352901 12:128060097-128060119 CAGAGAAAACAAAACAGAGGAGG - Intergenic
1105028070 12:132862884-132862906 AAAAGAAAACAAAAGAAATGAGG - Intronic
1106308188 13:28532058-28532080 AAGAGAAAGAAAAAGAAAGGGGG + Intergenic
1106823005 13:33487469-33487491 CTGTGAAAAGAAAAGAAAGGGGG + Intergenic
1106825571 13:33516940-33516962 CAGAAAAAAAAAAAAAAAGGAGG + Intergenic
1106910787 13:34461457-34461479 CAGAGTACACTTGAGAAAGGAGG - Intergenic
1106977523 13:35238389-35238411 CAGAGAGAATAAAAGACAGGAGG - Intronic
1107115563 13:36742266-36742288 GATAGAAAACAAGAGAAAGGCGG - Intergenic
1107625039 13:42272965-42272987 CAGAGAAAAAAAATGAAAGCTGG - Intronic
1107672723 13:42762653-42762675 CAGAGTAAATAATATAAAGAAGG + Intergenic
1107745398 13:43501187-43501209 AACAGTAAACAAAATAAAGCAGG + Intronic
1107779403 13:43881628-43881650 AACAGTCAACAAAAGAAAGGAGG - Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108229914 13:48326267-48326289 CAGAGGAAAAAAAAGAAATTAGG - Intronic
1108304086 13:49113342-49113364 AAGAGAATACAAAAGAAAGGGGG - Intronic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108428096 13:50325541-50325563 GATAGTAAACAAAACAAAGAAGG - Intronic
1108539196 13:51421360-51421382 CACAACAAACAAAACAAAGGGGG + Intronic
1108819884 13:54335747-54335769 CAGAATAAAAAAAAAAAAAGTGG - Intergenic
1109037096 13:57277904-57277926 CTGAGTAAATAAAATAAATGAGG + Intergenic
1109297003 13:60545935-60545957 CATAGAAAACAAAATAAAAGAGG - Intronic
1109765209 13:66886355-66886377 CAGAGTTAAAATCAGAAAGGGGG + Intronic
1109971824 13:69780249-69780271 CAGTGAAAACAACAAAAAGGAGG - Intronic
1110093880 13:71490568-71490590 CAGAGTAAGCAAACTAAAGTAGG + Intronic
1110138183 13:72094651-72094673 CATATTAAAAAAAAGAAAGATGG + Intergenic
1110271002 13:73590739-73590761 CAAAATAAACCAAAGAAAGCAGG - Intergenic
1110369784 13:74727196-74727218 AAGAGAAAAGAAAAGAAAGAAGG + Intergenic
1110670593 13:78172738-78172760 CTGAGTAAAAAAAAAAAATGAGG + Intergenic
1110893168 13:80715276-80715298 GAGAGTAGACAAAAGCAAGCAGG + Intergenic
1111520785 13:89400930-89400952 AAGGGTATACAAAAGAAAAGTGG - Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111599619 13:90455860-90455882 AACAGTAAACAAAGAAAAGGTGG + Intergenic
1111836758 13:93397756-93397778 CAGAGAAAAAAAAAAAGAGGAGG - Intronic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1111971121 13:94917940-94917962 CAGAGCAAACAAGAGAAAACAGG + Intergenic
1112181063 13:97081259-97081281 CAGGTTAAACATAAGAAAAGGGG + Intergenic
1112413250 13:99181491-99181513 CAGATTTTACAAAAGAAAAGTGG - Intergenic
1112756875 13:102645482-102645504 CAGATTAAACAAAAGAAACCAGG - Intronic
1113062648 13:106339966-106339988 CAGAGGATACAAACGAAGGGAGG + Intergenic
1113243715 13:108369936-108369958 CTGAATAAAGAAAAAAAAGGGGG + Intergenic
1113503516 13:110796839-110796861 AAGAGAAAAGAAAAGAAAGCAGG - Intergenic
1114042446 14:18691491-18691513 AAAAGAAAAGAAAAGAAAGGGGG + Intergenic
1114189650 14:20430576-20430598 CGGAGTAAGCAAAAGAGACGAGG + Exonic
1114326290 14:21591997-21592019 CAGAGAAAATAAATCAAAGGAGG + Intergenic
1114352300 14:21866451-21866473 CAGAGGAAACAATACGAAGGAGG - Intergenic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115829658 14:37322455-37322477 CAGAGTAAAACAAATAAATGTGG - Intronic
1115849318 14:37576550-37576572 TCGAGTAGGCAAAAGAAAGGTGG + Intergenic
1115962536 14:38851823-38851845 CAGAAAAAAAAAAAAAAAGGTGG + Intergenic
1116609275 14:47046165-47046187 TAAAGTAAATAAAAGAAAGGGGG + Intronic
1116725000 14:48552571-48552593 CAGAGGAGACAAAAGAAAAAAGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117595586 14:57324151-57324173 CAGAGGAAAAAAAAAAAAGTAGG - Intergenic
1117726393 14:58678898-58678920 CAGAGGAAAGAAAAGTAAGTAGG + Intergenic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118179042 14:63472653-63472675 AGGAATAAACAAAGGAAAGGTGG + Intronic
1118267838 14:64312489-64312511 AAGAGGAGAGAAAAGAAAGGTGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118449512 14:65887126-65887148 CAAAGAAAAAAAAAAAAAGGTGG + Intergenic
1118681666 14:68248178-68248200 AAGAGTAAACAGAAAAAATGTGG - Intronic
1118896141 14:69947156-69947178 CAAAGAAAAGAAAAGAAAGAGGG - Intronic
1119133468 14:72195513-72195535 CAGAGTAGAGAGAAGAAAAGAGG + Intronic
1119513236 14:75228032-75228054 AAAAGAAAAGAAAAGAAAGGGGG + Intergenic
1119524844 14:75314669-75314691 TAGAGAAAATAAGAGAAAGGGGG + Intergenic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1119794004 14:77379382-77379404 CAAAAAAAAAAAAAGAAAGGAGG - Intronic
1119877138 14:78070570-78070592 CTGAGAAAAGAAAAGAAACGTGG - Intergenic
1120251642 14:82066275-82066297 CAGAGTGAAAGAAAGAAAGAAGG - Intergenic
1120525640 14:85573925-85573947 CAGACTAATCAAAAGAAATGAGG - Intronic
1120526520 14:85583240-85583262 CACAGTATACAAAATGAAGGTGG - Intronic
1120551264 14:85875965-85875987 CAGAGGCAACAAAAGGAAAGTGG - Intergenic
1121057210 14:90867125-90867147 CAAAGCAAACAAAAGAAACAAGG + Exonic
1121345644 14:93133803-93133825 GAGTGTAAAAAAAAGAAAAGTGG - Intergenic
1121579762 14:95020333-95020355 AAGAGCAAAGGAAAGAAAGGTGG - Intergenic
1121849892 14:97212003-97212025 CATAGAGAACCAAAGAAAGGAGG + Intergenic
1121936437 14:98023443-98023465 CAGAGCAAATGAAAGAAATGGGG - Intergenic
1122745641 14:103895749-103895771 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
1122869149 14:104627333-104627355 CAGAGCAAAGAAATGAAAAGAGG + Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1124849852 15:33325773-33325795 AAGAGAAAAGAAAAGAAAGAAGG - Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1126838310 15:52690552-52690574 CAAAGTGAACAACAGAAAGAAGG + Intronic
1127105836 15:55614044-55614066 CCGAGTAAGCATAAGAAAGCTGG - Exonic
1127748757 15:62009357-62009379 AAGATTAAAAAAAAAAAAGGGGG + Intronic
1129433010 15:75515125-75515147 CAGAATAAAAAAAAGAAATCGGG + Intronic
1130193252 15:81756023-81756045 CAGAGAAAACAAGAGAAGAGAGG + Intergenic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130440465 15:83947584-83947606 CAAAGTACAGAAAATAAAGGAGG - Intronic
1130615354 15:85401459-85401481 CAGAGAAAACAAATCAAAGCTGG - Intronic
1130739721 15:86586161-86586183 GAGAGTAAGCAAGAGAGAGGGGG - Intronic
1130895285 15:88165529-88165551 GAGAGTAAACTAAAGAAAATTGG + Intronic
1131275574 15:90977888-90977910 AAGAGTAAACATAAATAAGGAGG - Intronic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131700457 15:94929911-94929933 TAGAGTAAACAAGAGAAATTGGG + Intergenic
1133443892 16:5843525-5843547 CAGAGTAGACAAAGAAAATGTGG - Intergenic
1134375087 16:13664653-13664675 CAGATTAAAAAAATGAAAGCTGG - Intergenic
1134488940 16:14681175-14681197 AAGAGAAAAGAAAAGAAAAGGGG + Intronic
1135103067 16:19623684-19623706 CAAAGTAAAAAAATAAAAGGAGG - Intronic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135560750 16:23474862-23474884 CAGGGAAAAAAAAAAAAAGGTGG + Intronic
1135692002 16:24545881-24545903 CAGACTAAACTAAAGAATGACGG + Intronic
1135796863 16:25453450-25453472 CAGGGGAAAAAAAAGAAAAGAGG - Intergenic
1136490752 16:30606491-30606513 AAGAAAAAAAAAAAGAAAGGTGG - Intronic
1136560611 16:31037060-31037082 CAAAGGAAAAAAAAAAAAGGGGG - Intronic
1136678051 16:31932429-31932451 AATAGTAATCAAAGGAAAGGTGG + Intergenic
1137285011 16:47008570-47008592 CAGAGTAAAGGAAAAAAAGCAGG + Intergenic
1137436773 16:48461163-48461185 AAGAGGAAGAAAAAGAAAGGAGG - Intergenic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1137747511 16:50834016-50834038 CAGAGTAAACAAATACAAAGAGG - Intergenic
1137863035 16:51865969-51865991 CAGAGTTGACAAGAGGAAGGAGG - Intergenic
1137914552 16:52414932-52414954 CAAAGCAAAGAAAAGAAAGGCGG - Intergenic
1138203592 16:55107934-55107956 TAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1139089839 16:63632015-63632037 CAGAGCAAAGACAAGAAAGGAGG + Intergenic
1139545884 16:67649361-67649383 CTGAGGGAACAAGAGAAAGGAGG - Intronic
1139663565 16:68439291-68439313 CAGAGTGAACCAAGGAACGGGGG - Intronic
1140224945 16:73069516-73069538 AAGATTAAGCAAAAGAAATGAGG + Intergenic
1140775711 16:78247388-78247410 CATGGCAAAAAAAAGAAAGGTGG - Intronic
1140818009 16:78638424-78638446 CAGAGGAAACAAAAAAAAAATGG - Intronic
1142693640 17:1621524-1621546 CAGAGCAAACAACAGGCAGGAGG + Intronic
1142828029 17:2526538-2526560 CAAAAAAAAAAAAAGAAAGGAGG + Intergenic
1142932661 17:3300132-3300154 CAGATTAAAAAAAAAAAAGAGGG - Intergenic
1143359081 17:6352851-6352873 CAGAGTACAAAAAAGAAGTGAGG + Intergenic
1143528870 17:7488953-7488975 CAGAGAAAACAAGGGAAGGGCGG - Intronic
1143558769 17:7679216-7679238 CAGTGCAAACAACAGAAAAGTGG - Intronic
1144297195 17:13887307-13887329 CAGAGAAAAAGAAAGAAAGAAGG + Intergenic
1144653999 17:17024112-17024134 CAAAGAAAAAAAAAAAAAGGTGG - Intergenic
1145828364 17:27894354-27894376 AAGAGAAAAAAAAAGAAAAGAGG - Intronic
1147717218 17:42516548-42516570 GAGTGAAAAGAAAAGAAAGGAGG - Intronic
1148245806 17:46029815-46029837 CAGAGTACCCCAAAGAACGGCGG + Intergenic
1148391577 17:47276525-47276547 CAAAGAAAACAAATGGAAGGAGG + Intronic
1148554299 17:48569062-48569084 CCGAGAAAAAAAAAGAGAGGGGG - Intronic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1148574214 17:48697678-48697700 AACATTAAACAAAAGAAAGCAGG - Intergenic
1148579490 17:48733952-48733974 GAGAGGAAAAAAAAGGAAGGAGG - Intergenic
1150028054 17:61699091-61699113 AATAGTAAACAAAAGAGAGCTGG - Intronic
1150202302 17:63370164-63370186 AAAAGAAAAAAAAAGAAAGGAGG - Intronic
1150906785 17:69346912-69346934 AAGAAAAAAGAAAAGAAAGGAGG + Intergenic
1151847188 17:76664850-76664872 GAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1152209030 17:78993244-78993266 CATAGGAAAGAAAAGAAACGAGG + Exonic
1152326930 17:79647022-79647044 CAGAGGAAATAAAATCAAGGAGG - Intergenic
1153292235 18:3512850-3512872 CACAGTAAAGAAAAAAAAGAAGG - Intronic
1153294230 18:3530414-3530436 AAAAGAAAACCAAAGAAAGGAGG + Intronic
1153508797 18:5830936-5830958 CAAAGAAAATAAAAGAAAGAAGG + Intergenic
1153537551 18:6118280-6118302 AAGAGTTAACCAAACAAAGGGGG - Intronic
1153906856 18:9669444-9669466 CATAGTAAACGAGAAAAAGGGGG - Intergenic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1155797379 18:30057515-30057537 AAGAGAAAAGAAAAGAAAGAGGG - Intergenic
1155943124 18:31819628-31819650 TAGGCTAAACAAAAGAAAGGGGG - Intergenic
1156251351 18:35355558-35355580 CAGAGAAAATAAAAGCAATGGGG + Intergenic
1156423588 18:36983277-36983299 AATAGTAACCAAAAGAAAGCTGG + Intronic
1156741421 18:40334241-40334263 CATAGTAACCAAAAGAGAGCAGG - Intergenic
1157348020 18:46858097-46858119 CAGAGTACAGAGAAAAAAGGCGG + Intronic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1158552101 18:58445124-58445146 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159446799 18:68550899-68550921 CATAGTAAATGAAAGAATGGAGG + Intergenic
1159682890 18:71377076-71377098 CAGAGAGAAGAAAAGACAGGTGG - Intergenic
1159736852 18:72110594-72110616 CTTAGTAAAGAAAAGATAGGAGG - Intergenic
1159791457 18:72784890-72784912 CACAGTGAACAAAAGAATGAGGG + Intronic
1159812201 18:73029654-73029676 AACAATAAACAAAAGAAAGCAGG + Intergenic
1160604047 18:80035642-80035664 CAGAGTACAGTAAGGAAAGGGGG - Intronic
1161139298 19:2638363-2638385 AAGAGAAAAGAAAAGAAAAGGGG + Intronic
1161476573 19:4489251-4489273 CAAAAAAAAAAAAAGAAAGGTGG - Intronic
1163339282 19:16694238-16694260 CAGCGAAAAAAAAAAAAAGGCGG + Intergenic
1163478059 19:17538626-17538648 GAGAGAAAAGAAAAGAAAAGAGG + Intronic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163751525 19:19081136-19081158 AAGAATAAAGAAAAGAAAGGAGG + Intronic
1163922941 19:20309999-20310021 CAGAGGAGAACAAAGAAAGGAGG + Intergenic
1164700336 19:30280249-30280271 GAGGGAAAACAAAAGTAAGGGGG - Intronic
1164923901 19:32110752-32110774 CAGAGAAATCACAAGACAGGTGG + Intergenic
1165298622 19:34951139-34951161 AATAGTAACCAAAAGAAAGCAGG + Intergenic
1165585140 19:36908532-36908554 CAGAGTAAGCAAAATTAAAGGGG + Intronic
1166146302 19:40838637-40838659 AAGAGAAAAGAAAAGAAAGAGGG - Intronic
1166321432 19:42021551-42021573 CACAGTGATCAGAAGAAAGGGGG + Intronic
1168701449 19:58442011-58442033 CAGAGGGAACAATGGAAAGGCGG - Intergenic
924967245 2:90395-90417 AACAGTAACCAAAAGAAAGCTGG + Intergenic
925498706 2:4480986-4481008 CACAGGAAACAAAGGAAAGAAGG + Intergenic
926493703 2:13557895-13557917 CAGAGTGAACACTAGACAGGGGG - Intergenic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926788858 2:16549254-16549276 CAAAATGAACAAAAGACAGGTGG + Intergenic
926875865 2:17478020-17478042 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
926902843 2:17774775-17774797 CAGAGAAAAAAAAAAAAATGGGG + Intronic
927353639 2:22148528-22148550 TAGAGTTAGCAAAAGAAAAGAGG - Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927659706 2:24982530-24982552 GAAAGGAAAGAAAAGAAAGGAGG + Intergenic
928901853 2:36327185-36327207 AAGAACAAACAAAAGCAAGGGGG + Intergenic
928987354 2:37194792-37194814 CAGATTGAAAAAAAGAAAAGAGG - Intronic
928988864 2:37209516-37209538 CAAAGTAAACAAAAACAAAGTGG + Intronic
929065137 2:37965045-37965067 AACAGTAAACAAAAGAGAGTGGG - Intronic
929430455 2:41881999-41882021 CAGAGTAAAGGAAAGAGAGAAGG - Intergenic
930197360 2:48522873-48522895 CAGAAAAAAAAAAAGAAAGAAGG + Intergenic
930394433 2:50802611-50802633 AAGAGGAAAGAAAAGAAAGAAGG + Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930815991 2:55598265-55598287 TAAAGTAAACAAAAGAAATTGGG - Intronic
931333059 2:61308070-61308092 CAAAGTAACAGAAAGAAAGGGGG + Intronic
931897753 2:66752060-66752082 CGGTGTTAACAAAAGAAAGGAGG + Intergenic
933203509 2:79478434-79478456 CAGAGTCAATAAATGAAAGGTGG + Intronic
933418006 2:82011817-82011839 AAAAGTAAACAAAAAAAAGTTGG - Intergenic
933867457 2:86534775-86534797 CATAGTAAATAAAAGACAGCAGG - Intronic
934516434 2:94990922-94990944 CAGATTTAACAGGAGAAAGGAGG + Intergenic
934589944 2:95539323-95539345 CAGAGTAAACAAATGAATTCAGG + Intergenic
934702089 2:96450702-96450724 GAGAGCAAAAAAGAGAAAGGAGG + Intergenic
934938662 2:98483741-98483763 CAGAGTAGCCAACAGGAAGGTGG - Intronic
934945723 2:98539921-98539943 AAGAGTAAAGAAGAGAAAAGAGG - Intronic
935271448 2:101437613-101437635 AAGAGAAAAGAAAAGAAAGAAGG + Intronic
935491769 2:103729852-103729874 AAAAGAAAACAAAAGAAAGAAGG + Intergenic
935970018 2:108521975-108521997 CAAAGTCAAGAAAAAAAAGGGGG + Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936133676 2:109870187-109870209 CAAAGTCAAGAAAAAAAAGGGGG + Intergenic
936211021 2:110501298-110501320 CAAAGTCAAGAAAAAAAAGGGGG - Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936406334 2:112207825-112207847 AACATTAAACAAAAGAAAGATGG - Intergenic
936686318 2:114830399-114830421 CTGACTAAAAGAAAGAAAGGAGG - Intronic
936997570 2:118431420-118431442 CAGAGTACAGAAAAGAGAGGGGG + Intergenic
937299571 2:120830794-120830816 CAGAGAGAACCAGAGAAAGGAGG - Intronic
937463436 2:122109370-122109392 CAGAGCAAGGTAAAGAAAGGAGG - Intergenic
937779049 2:125816274-125816296 CAGAACAAACAAAAGAAAGAAGG + Intergenic
938061341 2:128257239-128257261 AAGATTAATCAAAAGAAAGCAGG + Intronic
938469943 2:131550511-131550533 CAAAGCAAACAAAAGAAAATGGG + Intergenic
939174256 2:138731169-138731191 CAGGGTGAACAAAAGAAAAGTGG - Intronic
939270014 2:139927340-139927362 CAAAGTAAACAAAACGAATGTGG - Intergenic
939406577 2:141766012-141766034 GAGAGGAAACAAAAGCAATGGGG - Intronic
939538678 2:143465134-143465156 CAGAGAAAATAAAAAACAGGAGG - Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
940016108 2:149106835-149106857 GAGAGTAAAAAAAAGAGGGGAGG - Intronic
940085108 2:149850439-149850461 CAGAGAAAAGAAAAACAAGGAGG + Intergenic
940524966 2:154801477-154801499 AAAAGAAAAGAAAAGAAAGGAGG - Intronic
940991535 2:160102446-160102468 CATAGTAAGCAAAAGACAGCTGG - Intronic
941358361 2:164520230-164520252 CAAAGCAAACAAAAAAAAGTGGG + Intronic
941454582 2:165700287-165700309 CAGAGAAAAAAAAAGAAATTTGG + Intergenic
941979395 2:171438667-171438689 AACACTAAACAAAAGAAAGCTGG - Intronic
942330510 2:174818693-174818715 TAGAATAAACATATGAAAGGAGG + Intronic
942355112 2:175102756-175102778 AAGAGGAAAAAAAAAAAAGGAGG + Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942754688 2:179326485-179326507 AAGACTAAACCAAATAAAGGCGG + Intergenic
942995482 2:182255130-182255152 CAGAGCAAGCAAAACAGAGGTGG + Intronic
943035122 2:182734878-182734900 AACATTAAACAAAAGAAAGCTGG - Intronic
943142165 2:183996661-183996683 CAGAGCAAAATAAAGAAAAGAGG + Intergenic
943363437 2:186947378-186947400 CAGAAAAAAAAAAAGAAACGCGG - Intergenic
943793583 2:191964256-191964278 AAGAAAAAAGAAAAGAAAGGAGG - Intronic
943826525 2:192401157-192401179 CAGAGAAAAAAAAAAAAAAGAGG - Intergenic
943920195 2:193697671-193697693 CAGACTAATGAAAAGAAAGCAGG - Intergenic
944096879 2:195977446-195977468 CAGAGGAGACAAAAGAAAAAGGG + Intronic
944330479 2:198459995-198460017 TACAATAAACAAAAGAAAGCTGG - Intronic
944360907 2:198855227-198855249 CAAAGTCAACAAAAGCAATGGGG + Intergenic
944858140 2:203787785-203787807 CAGATTTAATAAAAGAAAAGAGG + Intergenic
945018241 2:205542880-205542902 CTGTGTAAACAAAAGAAATGTGG + Intronic
945636463 2:212358745-212358767 CAGAGTGAATTAAAGAAAAGAGG + Intronic
945806144 2:214492127-214492149 CATAGTAAACAAACCAAAGCAGG + Intronic
945834553 2:214823139-214823161 GAAAGAAAAGAAAAGAAAGGAGG + Intergenic
946319365 2:218941931-218941953 CAAAGTCAACAAAAGCAATGGGG - Intergenic
946595534 2:221301972-221301994 CAGAGTAACTAATACAAAGGAGG - Intergenic
946603957 2:221381048-221381070 CAGAGTAAATAAATGAACTGAGG + Intergenic
946652060 2:221903013-221903035 CAAAGTAAATAAAGGGAAGGAGG + Intergenic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
946897646 2:224340646-224340668 TAGGGTAAAGAAAAAAAAGGAGG - Intergenic
947029912 2:225782506-225782528 CAGAGGGAAAAAAAGGAAGGAGG - Intergenic
947212308 2:227719179-227719201 AAGAGAAAAGAAAAGAAAAGAGG - Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
947835586 2:233172484-233172506 CAGTGAAAATGAAAGAAAGGGGG + Intronic
1168745578 20:236896-236918 CAAAAAAAAAAAAAGAAAGGAGG + Intergenic
1168900607 20:1361283-1361305 CATAGTAAACAAAAAACAGGAGG + Intronic
1169036392 20:2455910-2455932 CAGAGGAAAGAAAAGGAAAGGGG + Intergenic
1169240979 20:3980626-3980648 CAGAGTATACAAAAAAATGATGG + Intronic
1169347909 20:4843802-4843824 CGAAGTAAAAAAAAAAAAGGTGG - Intergenic
1169634875 20:7678438-7678460 AAGAGTAATCATAAGAAAGCTGG + Intergenic
1169954650 20:11087792-11087814 AAGAGAAAGCAAGAGAAAGGGGG + Intergenic
1170017114 20:11793841-11793863 CAGCATAAACAAAAAAAAGCAGG - Intergenic
1170020196 20:11829120-11829142 CAGAGTTGAGAAAAGATAGGTGG - Intergenic
1170450832 20:16481837-16481859 CAGAGTAAACAAAATTAATAAGG + Intronic
1170819148 20:19741354-19741376 GAGAGAAAACAAAATAAAAGAGG + Intergenic
1170943494 20:20868708-20868730 CAGACTAAAAATAAAAAAGGAGG + Intergenic
1172043015 20:32059304-32059326 GAAAGAAAAGAAAAGAAAGGAGG - Intronic
1172215320 20:33231642-33231664 CAAAAGAAAAAAAAGAAAGGGGG + Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173356997 20:42302817-42302839 CAGAGTAAACAAATGCAAATGGG + Intronic
1173368071 20:42406323-42406345 CATATTAAAAAAGAGAAAGGTGG + Intronic
1173472417 20:43334072-43334094 CAGAGGAAAACAAAGGAAGGAGG - Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173890736 20:46507700-46507722 CAGATCAAAGAAAAGAAAGACGG - Intronic
1174378627 20:50142406-50142428 CAGTGTTAACAACAGAAAAGGGG + Intronic
1174447329 20:50598904-50598926 CAGAAAAAAAAAAAAAAAGGAGG + Intronic
1174772100 20:53309866-53309888 CCGAGGAAACAAAAGCAAGGAGG + Intronic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175283735 20:57822494-57822516 TACAGTAAACCCAAGAAAGGTGG - Intergenic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175590516 20:60186989-60187011 TACAGTAATCAAAAGAATGGTGG - Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177041798 21:16121758-16121780 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
1177386477 21:20415851-20415873 CAAAGCAAATAAAACAAAGGAGG - Intergenic
1177406823 21:20679856-20679878 CAGAGTCAACAAAAGCAAACCGG + Intergenic
1177421675 21:20867365-20867387 AAGAATGAAAAAAAGAAAGGGGG - Intergenic
1178002328 21:28176323-28176345 AAGAAAAAAGAAAAGAAAGGAGG + Intergenic
1179071110 21:38071893-38071915 TAGATTAAGCAAAAGAAAAGGGG - Intronic
1179118131 21:38513924-38513946 CAAAGTCAACAATAAAAAGGGGG + Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1180582185 22:16848621-16848643 AAGAGTAACCAAAAGAGAGCAGG - Intergenic
1181809091 22:25392585-25392607 CAGAGAAAAGCAAAGCAAGGAGG + Intronic
1182059937 22:27389559-27389581 AAGAGTGCACAGAAGAAAGGAGG + Intergenic
1183048862 22:35244668-35244690 CAGAGGAGAACAAAGAAAGGAGG - Intergenic
1184193801 22:42912834-42912856 CAGGGTAAGGTAAAGAAAGGTGG - Intronic
1184999376 22:48235014-48235036 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1185355464 22:50366894-50366916 AAAAGGAAACAAAAGACAGGAGG - Intronic
949538674 3:5015335-5015357 CAGAGTACAAGAGAGAAAGGAGG + Intergenic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
949891503 3:8736984-8737006 AAGAATAAAGAAAAGAAAGAAGG + Intronic
950213246 3:11139276-11139298 CAAAATAAAAAAAAAAAAGGCGG - Intronic
950841406 3:15971707-15971729 CAAAGCAAACAAAATAAAGTGGG + Intergenic
950848529 3:16039159-16039181 CAAAGTCAACAAAAGCAATGAGG - Intergenic
950914135 3:16626550-16626572 CAGAATAAAAAAAACAAGGGTGG + Intronic
951114586 3:18845106-18845128 CAAAATAAAAAAAAAAAAGGAGG - Intergenic
951194562 3:19809393-19809415 CAGAGTTAAAAAAAAAAAGGTGG + Intergenic
951242873 3:20307272-20307294 CAGAGTTAATAAAAGAGAGGAGG + Intergenic
951690645 3:25392157-25392179 CAAAGCAAACAAAAGCAAAGTGG - Intronic
952168914 3:30783637-30783659 CAGTGTAATAAAAAGAAAAGCGG + Intronic
952228207 3:31401023-31401045 CAGAGTAAACAAAAAATCTGCGG - Intergenic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
953559973 3:43980283-43980305 CAAAGTAAACAAAACAAAATTGG + Intergenic
953621300 3:44535205-44535227 GAGAGGCAACAAAGGAAAGGAGG - Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953950357 3:47184795-47184817 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
953991935 3:47490638-47490660 AAGAGAAGAGAAAAGAAAGGTGG + Intergenic
954013324 3:47663079-47663101 AAGAAGAAACAAAAGAAAAGAGG + Intronic
954592541 3:51795622-51795644 CAGATTAAAGAAAAAAAAGAGGG - Intergenic
955182122 3:56682672-56682694 AAGAGCAGAGAAAAGAAAGGTGG - Exonic
955399482 3:58581266-58581288 CAGAGGAACCCAAAGGAAGGGGG + Intronic
956141026 3:66147148-66147170 AAGAGAAAAGAAAAGAAAAGAGG - Intronic
956182002 3:66526220-66526242 CAGAGTAAAAAAAAAAATTGGGG - Intergenic
956291098 3:67661197-67661219 CAAAGTTAAGATAAGAAAGGAGG + Intergenic
956459510 3:69457143-69457165 AAGAAAAAAGAAAAGAAAGGAGG + Intronic
957725025 3:84053034-84053056 AAGAGTAAATAAAGAAAAGGTGG - Intergenic
957767636 3:84647089-84647111 CAGTGTAAAAACAAGAAAGCTGG - Intergenic
957786709 3:84891638-84891660 CTGTGGAAACAAAAGACAGGAGG - Intergenic
958044138 3:88263096-88263118 CAGAGTAGACAGTAAAAAGGAGG + Intergenic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
958811947 3:98870382-98870404 CTGAGCAAACAAAAGAAATCTGG - Intronic
958832230 3:99103397-99103419 CATAGTAAATAAAAGGGAGGTGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959118272 3:102203775-102203797 CAGAGGAAAAAAAGGAAAGAAGG - Intronic
959315692 3:104803695-104803717 AAATGTAAACAAAAGAAAAGAGG - Intergenic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
959626999 3:108463828-108463850 GAGAGGAGAGAAAAGAAAGGGGG + Intronic
959720240 3:109478823-109478845 GAGAGGAAGCAAAAGAGAGGAGG - Intergenic
959932608 3:111999967-111999989 CACAGTAAAACAAAGAAGGGAGG + Intronic
959998476 3:112704638-112704660 CAAAGCAAACAAAACAAAGTGGG + Intergenic
960500537 3:118432371-118432393 CATAGCAAACAAAAGAAAACTGG - Intergenic
960601783 3:119466089-119466111 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
960694083 3:120378639-120378661 TATATTAAAAAAAAGAAAGGTGG - Intergenic
960722429 3:120638062-120638084 GAGAGCAAGCAAGAGAAAGGAGG - Intronic
960766942 3:121142089-121142111 AATAGTAAACAAAAGTGAGGAGG + Intronic
960803629 3:121562382-121562404 AAGGGTAGAGAAAAGAAAGGAGG + Intergenic
960812595 3:121638710-121638732 AAGAGTAAGCATAAGAAAGATGG + Intronic
961690988 3:128669388-128669410 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
961728715 3:128951280-128951302 CAGAGTCCCAAAAAGAAAGGGGG + Intronic
961732873 3:128979981-128980003 AAGAGAAAAAGAAAGAAAGGAGG + Intronic
961964256 3:130886533-130886555 CAGAGAAGACAAAAGAAATAAGG - Intronic
962379335 3:134884676-134884698 CAGAATAACCAAAGGAAATGTGG - Intronic
962560113 3:136597286-136597308 CTTAGTAAAGAAAAGAAAGAAGG + Intronic
962995026 3:140618276-140618298 CAAAGTAAACAAAAACAAAGTGG + Intergenic
963095072 3:141528001-141528023 CAAAGTATTCAAAAGAAAGTTGG + Intronic
963125948 3:141816661-141816683 CAGAGTTAACAAAACAAAATGGG - Intronic
963258076 3:143166199-143166221 CGGAGAAAAAGAAAGAAAGGAGG - Intergenic
963885625 3:150579211-150579233 AAGAGTAAATAAAAGAAGAGGGG - Intronic
964123439 3:153210428-153210450 CAGGTTAAAAAACAGAAAGGAGG - Intergenic
965004443 3:163000914-163000936 AAAAATAAATAAAAGAAAGGGGG + Intergenic
965082889 3:164057681-164057703 AATAGTAACCAAAAGAAAGGAGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965219091 3:165903293-165903315 GAGAGGAAACAAAAGTAAGTAGG + Intergenic
965417638 3:168416954-168416976 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
965867600 3:173224686-173224708 CTGAGTAAACACAAGAGAGCAGG - Intergenic
966246543 3:177814259-177814281 AAAAGTAAACATAAGAAAGCTGG + Intergenic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
966402313 3:179561001-179561023 AAAAGAAAACAAAAGAAAGAAGG - Intergenic
966701124 3:182852324-182852346 CAGATTAAGCAAAAGAGAAGTGG + Intronic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
967341307 3:188401419-188401441 CTGAGTAAATAAAAGAAAACTGG - Intronic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
968173807 3:196531357-196531379 AAGACGAAAGAAAAGAAAGGCGG - Intergenic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
969180014 4:5433160-5433182 CAGAGTAGAGGATAGAAAGGAGG + Intronic
970015220 4:11505479-11505501 GAGAGCAAAAAAAAAAAAGGGGG - Intergenic
970253252 4:14139275-14139297 CAGACTAGACAAAAGAAAATTGG + Intergenic
970437651 4:16050977-16050999 GATAGTAAACAAAATAAAGTAGG + Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970499088 4:16658699-16658721 CAGTGTTAAAAAAAGAAAGCAGG + Intronic
970544855 4:17117463-17117485 AACAGTAATCAAAAGAAAGTAGG + Intergenic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
971597068 4:28543751-28543773 CAGAGTCAGGAAAAGAAAGGAGG - Intergenic
971626008 4:28921035-28921057 TAGAATAAATATAAGAAAGGAGG + Intergenic
971732109 4:30397723-30397745 TAAAGTTATCAAAAGAAAGGTGG + Intergenic
972366345 4:38378713-38378735 CAGAATAAAGAAAATAAAGACGG + Intergenic
972607557 4:40628241-40628263 CAGAAGGAAAAAAAGAAAGGAGG - Intronic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972863721 4:43204085-43204107 CAATGTAAACAAAAGAAAAGAGG + Intergenic
972950962 4:44321757-44321779 CAGAGGCTACAAAGGAAAGGAGG - Intronic
972957651 4:44412363-44412385 AAGAGTCAACAAAAGATTGGTGG - Intronic
973043859 4:45510328-45510350 AATAGTAACCAAAAGAGAGGAGG - Intergenic
973328147 4:48884839-48884861 CAGAGTAAAAGAAAGAATAGAGG + Intergenic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
974332869 4:60502962-60502984 AAAAGGAAAGAAAAGAAAGGAGG - Intergenic
974369903 4:61002266-61002288 AATAGTAACCAAAAGAAAGCAGG + Intergenic
974397482 4:61357555-61357577 CAGTGTAAACTAAAGAAAGCAGG - Intronic
974811379 4:66950477-66950499 GAGTGAACACAAAAGAAAGGTGG + Intergenic
974941242 4:68471215-68471237 AAGAGAAAAGAAAAGAAAGAAGG - Intronic
975026917 4:69560368-69560390 CAGAGGAGACAAAAGAAACAAGG + Intergenic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975691571 4:76969700-76969722 CTGAGTAAACACAACCAAGGAGG + Intronic
975839194 4:78455947-78455969 CAGAGTAATCCAAAGGCAGGTGG + Intronic
975980647 4:80154852-80154874 CAGAGAAAACAAAACAAACAAGG + Intergenic
976492725 4:85690709-85690731 AAGAGCAAAAAAAAAAAAGGGGG - Intronic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
977080261 4:92518153-92518175 CAGAGAAAGAAAAAAAAAGGGGG - Intronic
977262087 4:94809619-94809641 CAATGTACACAAAAGAAAGAGGG - Intronic
977353020 4:95912177-95912199 CAGACTAAAGAAAAGAACCGGGG - Intergenic
977359902 4:95988843-95988865 AAGAGTAAAAAAAGGCAAGGAGG - Intergenic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
978450140 4:108823431-108823453 GAGAGTAAAGAAGGGAAAGGAGG + Intronic
978500521 4:109404256-109404278 CAGAAAAAAAAAAAGAAAGAAGG + Intergenic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
978758000 4:112324957-112324979 CTGAGGAACCAAAAAAAAGGGGG + Intronic
978879543 4:113685065-113685087 GAGAGTAAACCAATGATAGGAGG + Intronic
978930272 4:114302487-114302509 CAGATAAAAACAAAGAAAGGAGG - Intergenic
979110480 4:116748559-116748581 CACCGTAAACAAAAGAAAACTGG + Intergenic
979207706 4:118060370-118060392 AATAGTAATCAAAAGAAAGCTGG - Intronic
979857250 4:125650188-125650210 CAGAAAAAAAAAAAAAAAGGCGG - Intergenic
979888799 4:126064152-126064174 CAGAGGAGAAAAAAGGAAGGAGG + Intergenic
980095934 4:128490891-128490913 AACATTAAACAAAAGAAAGCTGG - Intergenic
980196811 4:129599986-129600008 CAGAATGAACAAAAGAAAATGGG - Intergenic
980581016 4:134750382-134750404 CATTATAACCAAAAGAAAGGAGG + Intergenic
980804412 4:137793205-137793227 GAAAGAAAAGAAAAGAAAGGAGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981428000 4:144626070-144626092 GAGAGCAAACAAAAGAAAAATGG + Intergenic
981486152 4:145288691-145288713 CAGCGAAACCAAATGAAAGGTGG - Intergenic
981754084 4:148122379-148122401 CAAAGGGATCAAAAGAAAGGTGG - Intronic
982142057 4:152333476-152333498 AAGAGAAAAAAAAAGAAAGAAGG + Intronic
982340005 4:154286657-154286679 CAGAGGAGACAAAAGAAAAAAGG + Intronic
983034023 4:162839927-162839949 CAGAGCACACCAGAGAAAGGTGG - Intergenic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983333509 4:166361395-166361417 CACATCAAACAACAGAAAGGGGG - Intergenic
983418336 4:167485822-167485844 TAGACTAAACAAAGGAAAAGGGG + Intergenic
983791398 4:171801803-171801825 CCAAATAAACAAAAAAAAGGGGG - Intergenic
984149167 4:176105054-176105076 CAGAGTAGCAAAAAGAAAGCAGG + Intronic
984171573 4:176366323-176366345 AACAGAAAACAAAAGAAAGCAGG - Intergenic
984432468 4:179666094-179666116 CAGAGTACACAAAATGTAGGGGG - Intergenic
984671383 4:182492057-182492079 CAGAGTATAGAAAAGAAAGCAGG + Intronic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
985851855 5:2394271-2394293 TAGAGAAAAAAAAATAAAGGAGG + Intergenic
986628754 5:9748602-9748624 GAGAGTAAGCAAGAGAAAGAGGG + Intergenic
987390950 5:17375163-17375185 CAGAGACTACAAAAGAAGGGTGG - Intergenic
987898999 5:23986281-23986303 CAGATTATAAAAAAGAAAGAAGG - Intronic
987975748 5:25012817-25012839 CAGAGGAAGCAAAAGAGAGATGG + Intergenic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988528129 5:32004086-32004108 AAGATTAAAAAAAAAAAAGGTGG + Intronic
988922590 5:35957425-35957447 GAGAGATGACAAAAGAAAGGAGG + Intronic
989108031 5:37881577-37881599 CATAGTAAATAAAGAAAAGGAGG - Intergenic
989400390 5:41001735-41001757 AAAAGAAAACAAGAGAAAGGTGG + Intronic
989420335 5:41231010-41231032 AATAGTAAACAAAAGAGAGCAGG - Intronic
989520501 5:42395593-42395615 TAGAGAAAGCAAAAGAAATGAGG - Intergenic
989546794 5:42683671-42683693 CAGGGTAAAATAAAGAAAAGAGG + Intronic
989584398 5:43063328-43063350 GAAAGAAAAGAAAAGAAAGGTGG + Intergenic
989657550 5:43760681-43760703 CAGAGGAGACAAAAGAAAAAAGG - Intergenic
989830131 5:45906325-45906347 AAGAGTAGCCAAAAGAAAGCTGG + Intergenic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990355859 5:54965540-54965562 CAAAGTTAAAAAAAGAAAAGTGG - Intergenic
990444028 5:55876634-55876656 AATAGTAAACAAAAGAGAGCAGG - Intronic
990587761 5:57228621-57228643 CTGAGTAAAATAAAGAATGGAGG - Intronic
990690041 5:58353827-58353849 CAGAAGAAAGGAAAGAAAGGAGG + Intergenic
990758722 5:59104734-59104756 GAGAGGAAAAGAAAGAAAGGAGG + Intronic
990807941 5:59687886-59687908 CATGGAAAACAAAAAAAAGGTGG + Intronic
990888953 5:60627803-60627825 CAAAATAAAAAAAAGATAGGAGG + Intronic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991074169 5:62516690-62516712 CACAGTAAAAAAAAGAAAGCAGG - Intronic
991966695 5:72098689-72098711 GTTAGTATACAAAAGAAAGGAGG + Intergenic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
992510990 5:77434696-77434718 CAAAGAAAAAAAAAGAAATGAGG + Intronic
992967329 5:82016348-82016370 CAAAGCAAACAAAATAAAGTGGG - Intronic
993390736 5:87317559-87317581 CAGAAGAGACAAAAGATAGGTGG - Intronic
993404407 5:87493401-87493423 AGTAGTAAACAAAAGAAAGCAGG - Intergenic
993525294 5:88957959-88957981 GAGAATAAAGAAAAGAAAGCAGG - Intergenic
993698664 5:91092702-91092724 CAGAGTAAGAAAAATAAAGTTGG + Intronic
994204359 5:97017416-97017438 GAGAGTAAAAAAAAGCAAGATGG - Intronic
994412043 5:99418899-99418921 AAGAGGAAACAAAATAAAAGTGG - Intergenic
994481781 5:100346361-100346383 AAGAGGAAACAAAATAAAAGTGG + Intergenic
994873476 5:105383011-105383033 AAGAGTGAACAAAATATAGGAGG + Intergenic
995229351 5:109740898-109740920 CAGAATAAAAAAAAGAGAGAGGG - Intronic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
995928419 5:117405252-117405274 AAAAGTAAATAAAAGCAAGGAGG - Intergenic
996219034 5:120906257-120906279 CATAGAAAACAAAAGCAAGAAGG - Intergenic
996383145 5:122882730-122882752 AAGATTAAAAAAAGGAAAGGAGG - Intronic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996529153 5:124509668-124509690 CAGAGTACAAAGAAGACAGGTGG + Intergenic
996769032 5:127066155-127066177 CAGAGTACACCAAGGAAAAGGGG + Intronic
996771337 5:127088987-127089009 AAGAGTAAAAAAAAGAAAGTAGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
996904167 5:128578489-128578511 GAGGGGAAACAAAAGAAAGAAGG - Intronic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
997408529 5:133671739-133671761 CAGAGGAAAACAAAGGAAGGAGG + Intergenic
997769150 5:136537320-136537342 TAGAGTCAACAAAAGAAAACAGG + Intergenic
998382193 5:141733712-141733734 CAGATTACACAAAGGCAAGGGGG + Intergenic
998557258 5:143137603-143137625 CAGACTTATCAAAAGAAATGAGG - Intronic
998743912 5:145235220-145235242 CAGAGTATAGAAAGGAAAGAGGG + Intergenic
998770636 5:145540687-145540709 CAGAAAAAAAAAAAAAAAGGTGG + Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998977326 5:147662682-147662704 CAGAGTAACCTAGAAAAAGGGGG + Intronic
999026757 5:148242250-148242272 TACAGTAAAGAAAACAAAGGAGG + Intergenic
999504878 5:152184262-152184284 CAGAGGAAACACCACAAAGGGGG - Intergenic
999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG + Intergenic
1000165699 5:158646515-158646537 GAGAGGAAAAAAAAAAAAGGAGG - Intergenic
1000261978 5:159596893-159596915 CCAATTTAACAAAAGAAAGGAGG + Intergenic
1001503369 5:172256101-172256123 GAGAGAAAAAAAAAGAAAGATGG + Intronic
1001574160 5:172751078-172751100 GAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1001845184 5:174916000-174916022 CAGTGTAAGCAACAGAATGGAGG - Intergenic
1002117980 5:176979602-176979624 CAAAAAAAAAAAAAGAAAGGTGG + Intronic
1002951133 6:1812506-1812528 CAGAGGAAAGAAAGGCAAGGGGG + Intronic
1003073752 6:2965163-2965185 CATAGAAAACTAAGGAAAGGGGG - Intronic
1003164636 6:3665597-3665619 AAGTTTAAACAAAAGAAAAGAGG + Intergenic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1004058857 6:12170843-12170865 CACAGGACACAAAAGTAAGGAGG + Intergenic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1005817930 6:29571962-29571984 CAGAGTAAAAAGAATATAGGAGG + Intronic
1005831186 6:29672526-29672548 CAAAGGAGACAAAACAAAGGAGG - Exonic
1006019273 6:31108117-31108139 AAAAGAAAAGAAAAGAAAGGCGG - Intergenic
1006279171 6:33033687-33033709 AAGAGCAACCAAAAGAAAGCTGG - Intergenic
1007065900 6:38990268-38990290 CACAGTAAAATAAAAAAAGGGGG - Intronic
1007128069 6:39444231-39444253 AAAAGAAAAAAAAAGAAAGGTGG - Intronic
1007286674 6:40752861-40752883 CACAGTAAACAAGAGAGAAGGGG - Intergenic
1007367064 6:41402093-41402115 CAAAGTAAAAGAAAGAAAAGAGG + Intergenic
1007861203 6:44910691-44910713 CAAATTAAAAAAAAAAAAGGGGG + Intronic
1007900991 6:45412670-45412692 CAGAGTAAAAAAAAAAAAGTAGG - Intronic
1008010176 6:46458162-46458184 CAGAGCAAAGGACAGAAAGGTGG + Intronic
1008224496 6:48897467-48897489 CAGAGTAATCAAAAGACAGTTGG - Intergenic
1008347980 6:50453100-50453122 AGGAGAAAAGAAAAGAAAGGAGG + Intergenic
1008429700 6:51401091-51401113 CAGAATAAAGAAAGTAAAGGTGG + Intergenic
1008515249 6:52312836-52312858 CATAGTGAAAAAAAGAAAGAAGG + Intergenic
1009247158 6:61252645-61252667 TAGAAAAAACAAAAGAAATGAGG + Intergenic
1009415620 6:63412956-63412978 AAGAGAAAAGAAAAGAAATGAGG + Intergenic
1009585863 6:65600797-65600819 CATAGTAATCAAAACAAAAGTGG + Intronic
1009950736 6:70392795-70392817 CAGAGATAAAATAAGAAAGGAGG + Intergenic
1010345889 6:74810508-74810530 AAGAGAAAAGAAAAGAAAGAAGG + Intergenic
1010561973 6:77362004-77362026 GAGAGGAAGCAAAAGAGAGGAGG - Intergenic
1010874007 6:81078796-81078818 CAAACTAGACAAAACAAAGGAGG - Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011349583 6:86407811-86407833 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1011920896 6:92576764-92576786 CAGAATAAAGAAAAGCAAGGTGG + Intergenic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012222244 6:96662828-96662850 CACAGTCAACAAAAGCAATGGGG + Intergenic
1012454207 6:99386475-99386497 CATTGTAAACAAAACAAAGCCGG + Intronic
1012704555 6:102504885-102504907 CATAGTAGCCAAAAGAAAGCAGG - Intergenic
1012798895 6:103800358-103800380 CAGAGTAAAAACAAAAAGGGAGG + Intergenic
1012882998 6:104814117-104814139 AAGAATAAAGAAAAGAAAGGGGG + Intronic
1012976251 6:105784095-105784117 GAGAGCAAAAATAAGAAAGGTGG - Intergenic
1012978749 6:105808169-105808191 AAAAATAAACAAAAGATAGGAGG + Intergenic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013110973 6:107064808-107064830 CAAAGTGAAAAAAAAAAAGGCGG + Intergenic
1013113796 6:107085452-107085474 AAGAAAAAACAAAAGAAAAGAGG - Intronic
1013136266 6:107285837-107285859 CAAAGAAAACAAAGGATAGGGGG + Intronic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013630143 6:111978737-111978759 CAATGTAAACAAAAGCAAAGAGG - Intergenic
1013704099 6:112812382-112812404 TCTAGTAAACAAAAGAAAGCTGG - Intergenic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1014248726 6:119094760-119094782 AAAAGTAAAAAAAAAAAAGGAGG + Intronic
1014312231 6:119818428-119818450 CAGATAAAAGAAAAGAAGGGTGG + Intergenic
1014499425 6:122166645-122166667 CAGATAAATCAAAAGAAAGATGG + Intergenic
1015155752 6:130094236-130094258 AAGAGCAAAGAAAAGAAAGAAGG - Intronic
1015265088 6:131283542-131283564 AAGAGTGAAAAAAAGAAATGAGG - Intergenic
1015309864 6:131754848-131754870 CAAAGTAAACAAATGACAAGTGG - Intergenic
1015318465 6:131844587-131844609 GAAAGTAAAGAAAAGAAAGGAGG + Intronic
1015323345 6:131900602-131900624 CAGAGGCAACAAAAGGAATGGGG - Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017593703 6:156005742-156005764 GAGAATAAACATAAAAAAGGAGG + Intergenic
1018082602 6:160271296-160271318 GAGAGGCAACAAAAGGAAGGAGG - Intronic
1018595195 6:165471645-165471667 CAGAGGGAAGAAAGGAAAGGAGG - Intronic
1018631258 6:165825165-165825187 AAAAGAAAAAAAAAGAAAGGGGG + Intronic
1019336462 7:485190-485212 GGGAGAGAACAAAAGAAAGGAGG + Intergenic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019865107 7:3700947-3700969 TAGAGTAAAGAAAAAAAATGTGG + Intronic
1020048823 7:5066836-5066858 CTGGGTAAACAAAACAAAGATGG + Exonic
1020083209 7:5297342-5297364 AAGAGTACACAGAATAAAGGAGG - Intronic
1020392507 7:7673707-7673729 CACAGTTAAAAAAAAAAAGGGGG - Intronic
1020481460 7:8667876-8667898 CAGAGGAGAAAAAAGAAAAGAGG - Intronic
1020635489 7:10691546-10691568 AAAAGGAAAGAAAAGAAAGGGGG + Intergenic
1020873245 7:13661133-13661155 CAGAGTAAAAAAAAAAAAAAAGG + Intergenic
1021511622 7:21439496-21439518 AAAAGGAAAGAAAAGAAAGGAGG - Intronic
1021988073 7:26116562-26116584 CAAAGTAAGCCAAAGAAAGTTGG + Intergenic
1022365051 7:29705237-29705259 CAAAGTAAGCAGAAGAAATGAGG - Intergenic
1022381198 7:29861488-29861510 AAGAGAAAACAAAGGAAAGGAGG - Intronic
1022932657 7:35136352-35136374 CAAAGTAAGCAAAAGAAATGAGG + Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023283036 7:38591260-38591282 AAAAGAAAAGAAAAGAAAGGAGG - Intronic
1023319858 7:38983387-38983409 CAAAAAAAAAAAAAGAAAGGAGG - Intronic
1024082965 7:45870911-45870933 CAGAGTAAAGTTAAGAAATGGGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024440342 7:49408893-49408915 CAGAGCAAAAAAAAAAAGGGGGG + Intergenic
1027277857 7:76579802-76579824 AATAGTAAAGAAAAGAAAGAAGG + Intergenic
1027543652 7:79499895-79499917 GAGAGCAAGCAAGAGAAAGGAGG - Intergenic
1027910961 7:84249928-84249950 CAGAGTAAAAAAAAAAAAACAGG - Intronic
1028028244 7:85874427-85874449 GAGAGTCAACAAGAGCAAGGAGG - Intergenic
1028218725 7:88168112-88168134 GAGAGGAAAAAAAAGAAAGAAGG - Intronic
1028444074 7:90899174-90899196 CAGAGCAAATAAAAGACAAGTGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029130492 7:98326633-98326655 CAGATTAGAAAAAAGAAATGGGG + Intronic
1029409286 7:100398454-100398476 CAGAGGAAAGGAAAGAGAGGTGG - Intronic
1029828579 7:103229138-103229160 CAAAGTAAGCAAAAGAAATGAGG + Intergenic
1030188124 7:106783724-106783746 CAGAGTAAAGAAATGACAGAAGG + Intergenic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030989014 7:116277707-116277729 AACAGTAAACAGAAAAAAGGAGG - Intergenic
1031023829 7:116658683-116658705 CAATGTAAAAAAAAGAAGGGGGG + Intergenic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1031960366 7:127983959-127983981 AGGTGTAAACACAAGAAAGGAGG - Intronic
1032970532 7:137158179-137158201 AACAGTAAACAAAATAAAGGAGG - Intergenic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1033356501 7:140604812-140604834 CACAGTAAACAATATAAATGTGG - Intronic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1033612152 7:142973795-142973817 AACATTAATCAAAAGAAAGGAGG + Intergenic
1033669190 7:143474054-143474076 AATAGTAAACAAAAGAAATCAGG + Intergenic
1034012371 7:147543528-147543550 CAGAACAAACAAAGGAAAGTAGG - Intronic
1034231127 7:149529368-149529390 CAGAGGAGACAAAAGGAAAGAGG + Intergenic
1034232397 7:149541349-149541371 AACAGTAATCAAAAGAAAGCTGG + Intergenic
1034431287 7:151042461-151042483 CAGACTGAACAGAAGAAATGGGG + Intronic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1036109377 8:5880412-5880434 CAAAGCAAACAAAAACAAGGTGG + Intergenic
1036685538 8:10907183-10907205 TGGTGTAAACATAAGAAAGGAGG + Intronic
1037988489 8:23304318-23304340 CAGAATAAACAAGGGAAACGGGG + Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1038590403 8:28832200-28832222 GAGAGAAAAGAAAAGAAGGGAGG + Intronic
1038627107 8:29204765-29204787 CAGACCAAAAAAAAAAAAGGCGG + Intronic
1038839911 8:31174848-31174870 AAGAGAAAGAAAAAGAAAGGAGG - Intergenic
1039384392 8:37119723-37119745 AAGACTAATCAAAAGAAAGTTGG + Intergenic
1039524550 8:38202555-38202577 CAGAAAAAAAAAAAAAAAGGGGG - Intronic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040575943 8:48651649-48651671 CATTGTGAACAACAGAAAGGTGG - Intergenic
1040845456 8:51833224-51833246 CTGGGTAAGCAAAACAAAGGAGG + Intronic
1040857697 8:51966718-51966740 AACACTAAACAAAAGAAAGCTGG + Intergenic
1041258976 8:56003723-56003745 AAAAGGAAATAAAAGAAAGGAGG + Intronic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1042123683 8:65515117-65515139 CAGAGTAAAATTAAGAAAGATGG + Intergenic
1042307763 8:67349171-67349193 GAGAACAAATAAAAGAAAGGTGG - Intergenic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1043124929 8:76380537-76380559 AAGAGTAAACACAAGAAATCTGG - Intergenic
1043500329 8:80848059-80848081 CACAGTAATCAAAAGGAATGAGG + Intronic
1043600126 8:81927710-81927732 CAGAATAAATAAAAGAACTGAGG + Intergenic
1043790584 8:84462903-84462925 CAGGTTATACAAAACAAAGGTGG - Intronic
1044436468 8:92169964-92169986 GTGAATAAACAAAACAAAGGGGG - Intergenic
1044581179 8:93827760-93827782 CATAGTAAAAAAAAAAAAGAAGG - Intergenic
1044984933 8:97748875-97748897 AAAAGTAAATAAAAGAAAAGAGG + Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045087416 8:98701231-98701253 AAGAGAAAAGAAAAGAAAGAGGG + Intronic
1045355236 8:101381617-101381639 CAGAATAAAGCACAGAAAGGAGG - Intergenic
1045495311 8:102703203-102703225 CAGAGGAAACAAAAAACAGTGGG - Intergenic
1046005961 8:108484373-108484395 CAGAACAAATAAAAGAAAGTTGG - Intronic
1046057175 8:109092916-109092938 CAGTGAAAACATAAGAAAAGCGG - Intronic
1046068927 8:109226930-109226952 GAGAGGGAACAAGAGAAAGGAGG - Intergenic
1046427920 8:114080012-114080034 CAGAAAAAAAAAAAAAAAGGGGG - Intergenic
1046467544 8:114626018-114626040 CAAAGTAAACAAAAGCAAAGTGG + Intergenic
1048099530 8:131334854-131334876 CATAGTAACCAAAAGAGAGCAGG + Intergenic
1049375116 8:142285704-142285726 CAGAGTAAGGAACAGAAACGTGG + Intronic
1050175270 9:2863674-2863696 CAGAGCAAGAAAAAGTAAGGGGG - Intergenic
1050340050 9:4627784-4627806 CAGCCTCAGCAAAAGAAAGGTGG + Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050437337 9:5625133-5625155 AAGAGTACACATAAGAAATGGGG - Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1050795059 9:9528736-9528758 CAGATAAAAAGAAAGAAAGGAGG + Intronic
1050820942 9:9879191-9879213 TAGAATAAACAAAAGAAAAAAGG - Intronic
1051047347 9:12890269-12890291 CAGAGGAGACAAAAGAAAAAAGG + Intergenic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051526604 9:18051832-18051854 CTGAGTAGACAAAAAAAAGTAGG + Intergenic
1051576330 9:18620119-18620141 CAGAGTTAACAATGGAAGGGAGG - Intronic
1051661079 9:19427632-19427654 AAGAGAAGAGAAAAGAAAGGAGG - Intronic
1051905295 9:22088031-22088053 CAGAAGAACTAAAAGAAAGGAGG + Intergenic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1052299687 9:26939721-26939743 AACAGCAAACAAAAGAAAGCAGG + Intronic
1052430650 9:28362411-28362433 CAGAAGAATCAAAAGAAAAGAGG + Intronic
1052505252 9:29345018-29345040 CACAGTAAACAAAAAAAAGGGGG - Intergenic
1053064199 9:35056097-35056119 CAAAGTACATAAAATAAAGGTGG + Exonic
1053252221 9:36584303-36584325 AAAAGTAAAGAAAAGAAAAGAGG - Intronic
1054994183 9:71365944-71365966 CAAAGTAAAATAAAAAAAGGGGG + Intronic
1055151172 9:73002328-73002350 AACAGTAATCAAAAGAAAGTGGG - Intronic
1055329267 9:75165665-75165687 AATAGTAACCAAAAGAAAGCTGG - Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1055605404 9:77965112-77965134 CAGAGTAAAGTAAAAAAGGGTGG - Intronic
1055653172 9:78427583-78427605 TAGACTAATCAAAAAAAAGGGGG - Intergenic
1056734284 9:89192531-89192553 GATAGTAACCAAAAGAAAGAAGG + Intergenic
1057366674 9:94428596-94428618 CATAGTAAAAAAAAAAAAGGGGG - Intronic
1057466980 9:95323270-95323292 CAGAGCAAAAAAAAAAAAGGAGG + Intergenic
1058130354 9:101245669-101245691 CAGAGAAAACAAAAGAACCTGGG - Intronic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1059075039 9:111183935-111183957 CAAAGTAAACAAAAACAAAGTGG - Intergenic
1059107491 9:111524367-111524389 AAGAGGAAACAAGAGTAAGGTGG + Intergenic
1059203635 9:112442853-112442875 AAGAATAAATAAAAGAAAGCTGG - Intronic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1059846257 9:118280293-118280315 CAGAGTTAGCAAATGAATGGTGG - Intergenic
1060752366 9:126181734-126181756 CACAGAAAGCAAAGGAAAGGGGG - Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1185862880 X:3595373-3595395 GAGAGGAAAAAAAAGAAAGTTGG + Intergenic
1186202004 X:7164429-7164451 AAGAGTACAGAAAAGGAAGGAGG - Intergenic
1186240394 X:7559296-7559318 CAGAGGGAAAAAAAGAAAGAAGG - Intergenic
1186383460 X:9085587-9085609 CCCAGAAAACAAAAGAAGGGAGG - Intronic
1186605597 X:11087021-11087043 AAGACTAATCAAAAGAAAGCTGG - Intergenic
1186862350 X:13685595-13685617 CAGAGTAAATAAGACACAGGAGG - Intergenic
1188207273 X:27375887-27375909 CAGAGGAAAACAAAGGAAGGAGG - Intergenic
1188212463 X:27441979-27442001 CAGAGAAAAGAAAAGACAGCTGG + Intergenic
1189006087 X:36996658-36996680 CAAAATAAACAAAATAAAAGTGG + Intergenic
1189393800 X:40602348-40602370 CAGAGTAAATAAAGAAGAGGAGG + Intronic
1189451471 X:41135929-41135951 CATAGTATACAAAAGAACAGAGG - Intronic
1189556790 X:42153391-42153413 CACAGGAAACAAAGTAAAGGAGG - Intergenic
1192019126 X:67365833-67365855 AACAGTAATCAAAAGAAAGCTGG + Intergenic
1192733568 X:73826608-73826630 AAGTGTAAACAATAGAAAAGAGG + Intergenic
1192923931 X:75736062-75736084 CACAGGAAACAAAAGAAAACAGG - Intergenic
1193288399 X:79741016-79741038 CAAATTAAACAAAATACAGGAGG - Intergenic
1193319608 X:80106126-80106148 CAGAGCACAGAAAAGAAAAGTGG + Intergenic
1194480706 X:94419734-94419756 AATAGTAAACAAAAGAGAGCAGG - Intergenic
1194970055 X:100333024-100333046 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
1195374023 X:104208242-104208264 AATAATAACCAAAAGAAAGGTGG + Intergenic
1195889364 X:109675290-109675312 AAGAGTAAAAAAAACAAAGAAGG - Intronic
1195931653 X:110083467-110083489 CAGAGAAAGCAAAAGAAATCTGG - Intronic
1196002203 X:110797441-110797463 CACTGTTAACAAAGGAAAGGGGG + Intergenic
1196591254 X:117487554-117487576 CAGAATAAACAGAATAAAAGAGG + Intergenic
1196666431 X:118321901-118321923 AAGAGAAAAGAAAAGAAAAGAGG + Intergenic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1197483593 X:127018834-127018856 GCAAGGAAACAAAAGAAAGGAGG - Intergenic
1198082413 X:133252344-133252366 AAGAGAAAAGAAAAGAAAGAAGG + Intergenic
1198247408 X:134843403-134843425 TAGGGTAAAAAAAAAAAAGGGGG + Intronic
1198313309 X:135441006-135441028 AATAGTAAACAAAAGAGAGCAGG + Intergenic
1198446257 X:136718186-136718208 CATACTAATCAAAAGAAAGCTGG + Intronic
1198736878 X:139795584-139795606 CAGAGTAAAATAAAAAAAAGGGG + Intronic
1198794734 X:140383277-140383299 CAGAGTAAGCAAAAGGTATGAGG - Intergenic
1198801370 X:140451238-140451260 AAGAGTGAGCACAAGAAAGGAGG + Intergenic
1198824304 X:140683118-140683140 CATCTTAAACAAAAGAAAAGAGG - Intergenic
1199151722 X:144494777-144494799 CAGAGGAGACCAAAGGAAGGAGG + Intergenic
1199234463 X:145474957-145474979 CAGAGGACACCAAAGGAAGGAGG + Intergenic
1199332165 X:146575094-146575116 CAGAGGAGACCAAAGGAAGGAGG + Intergenic
1199530584 X:148843243-148843265 CAGATTAAAAAAAAAAAAGGGGG - Intronic
1201676144 Y:16586715-16586737 CAGAGAGAGAAAAAGAAAGGGGG - Intergenic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1201716783 Y:17053330-17053352 CAGAGAACCCAAAAGAAAGCAGG - Intergenic
1202069502 Y:20976167-20976189 CAAAGTATAGAAAAGAAAAGTGG + Intergenic