ID: 936104326

View in Genome Browser
Species Human (GRCh38)
Location 2:109612328-109612350
Sequence GTGGTTATAAAAAGGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936104326 Original CRISPR GTGGTTATAAAAAGGCATTA AGG Intronic
901523419 1:9803500-9803522 GTAGTTATAAAAATGTTTTACGG + Intronic
905507390 1:38490761-38490783 GTATTTAGAAAAAGGCATTTTGG - Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906730543 1:48077116-48077138 GTGGATATAAAAATGCTTGAGGG + Intergenic
907581545 1:55576635-55576657 ATGGGTATAGACAGGCATTAGGG + Intergenic
908756076 1:67470089-67470111 GTGTATATAAAAAGGAATGAAGG + Intergenic
909216114 1:72891855-72891877 GTAGTTATACAAAGTCATTATGG - Intergenic
910424289 1:87103297-87103319 ATGGTAATAAAGAGGCATTGAGG + Intronic
912240866 1:107906746-107906768 GTGATCATAAAAAGTCATTAAGG - Intronic
912571389 1:110626470-110626492 GTGGTTATCTACAGGGATTATGG + Intronic
914891602 1:151629241-151629263 GTTTTTATAAAAAGTCAATAGGG - Intronic
915219305 1:154361578-154361600 GTTTTTATAAAAAGACATTCTGG + Intergenic
915864561 1:159485284-159485306 GTGATTATAAAAAGGGACCATGG + Intergenic
917000274 1:170350158-170350180 GTGGCTATAAAAAGACCTTTGGG + Intergenic
918593255 1:186263314-186263336 GTGGTTCTAAAGAGGGACTAGGG - Intergenic
919738511 1:200968573-200968595 ATGGTTATCAAAAGGGAATATGG + Intergenic
919762224 1:201105509-201105531 GTGGTTATAAAAATGGGTTCTGG - Intronic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
922249947 1:223839472-223839494 GTGGTAATAAAAAATGATTAAGG - Intronic
923200929 1:231710719-231710741 GTCCTTATAAAAAGAGATTAAGG - Intronic
923336100 1:232971466-232971488 GTGGTGGTAAACAGCCATTAGGG + Intronic
1063359798 10:5442965-5442987 CTTGTTATAAAAAGGCTATAAGG + Intronic
1065484556 10:26225254-26225276 CTGGTGATAAAAAGGCAGGATGG - Intronic
1065971105 10:30806594-30806616 CTGGTTAAAAAAACACATTAGGG + Intergenic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1068426243 10:56868211-56868233 GTACTTATAAAAAGGCTTAAGGG + Intergenic
1070690072 10:78517870-78517892 GAGGATATAAAGAGGAATTAGGG + Intergenic
1070792546 10:79197957-79197979 GTCGTTATTAAAAAGCATTTTGG + Intronic
1071314391 10:84379672-84379694 ATGGATATATAAATGCATTAAGG - Intronic
1074382885 10:112994712-112994734 GTGGTTATAAAAAGTGGTTTGGG + Intronic
1077727431 11:4688835-4688857 GGGGTGATAGAAAGGCATCAGGG + Intronic
1078314672 11:10284381-10284403 GTGGTTATAAAAGGGTAATTGGG - Intronic
1078596663 11:12692980-12693002 GTGGTTTTCAAAAGCCTTTATGG - Intronic
1079040268 11:17053026-17053048 GTGGGTTTAAAAAGGCAGCAAGG + Intergenic
1079740615 11:24055131-24055153 GTTGTGATAAAAAGTCATCAAGG + Intergenic
1080119189 11:28656768-28656790 GTGTTTATAGAATGGCACTAAGG + Intergenic
1080272796 11:30468491-30468513 CTGAATATAAAATGGCATTAAGG + Intronic
1080686362 11:34518651-34518673 GTGCTTTTATAGAGGCATTATGG - Intergenic
1081009805 11:37796845-37796867 GTGGTTACAAAACTGAATTATGG - Intergenic
1081092751 11:38893409-38893431 GTAGTTATAAAAGAGCATTGTGG + Intergenic
1084353605 11:68622303-68622325 GTGGTTATACAACATCATTAGGG + Intergenic
1086176216 11:83894142-83894164 GTGGTTACAAGAAGGCAACAAGG - Intronic
1087003738 11:93447385-93447407 GTGACTAAAAACAGGCATTAGGG - Intergenic
1091043399 11:132303457-132303479 GTCCTTATAAAAAGGGATTCGGG - Intronic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1093420560 12:18969501-18969523 GGTGTTGTAAAATGGCATTATGG - Intergenic
1095929547 12:47611978-47612000 GTTGCTATAAAAAGGGCTTATGG - Intergenic
1099701986 12:86096183-86096205 GAATTTTTAAAAAGGCATTAAGG - Intronic
1100080156 12:90839185-90839207 GGGGTTATAAAATAACATTAAGG - Intergenic
1100464502 12:94833434-94833456 GTGGCTGAAAAAAGGAATTATGG + Intergenic
1101059556 12:100956966-100956988 TTAATTTTAAAAAGGCATTAAGG - Intronic
1101479330 12:105082335-105082357 TTGATTATAAATAGGCATAAAGG - Intronic
1103852391 12:123941545-123941567 CTGTTTAGAAAAAGGCATTGTGG + Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1107239737 13:38217977-38217999 GTGGGTATAAAATAGCATTCTGG + Intergenic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1109073232 13:57796635-57796657 GTAGTTTTAAATAGGAATTATGG + Intergenic
1109156871 13:58922179-58922201 CTGGAGATGAAAAGGCATTAGGG - Intergenic
1109959913 13:69616481-69616503 GTGAATCTAATAAGGCATTACGG - Intergenic
1110111561 13:71753767-71753789 TTGGTTTTAAAAAGGAAATATGG - Intronic
1110660151 13:78051213-78051235 GCGGCTATAAAAAGGAATGAGGG + Intergenic
1115597092 14:34919890-34919912 GTTGTTATTAAAAGGTATTGAGG - Intergenic
1116060304 14:39915763-39915785 GTGCTTCTAAAGAGGCTTTATGG + Intergenic
1116104355 14:40481345-40481367 GTCTTTGTAAAAAGGCTTTATGG - Intergenic
1116187389 14:41614638-41614660 GTAGTTAGAAAAAGGAACTATGG + Intronic
1117266857 14:54098089-54098111 GTTGTTATAAAAGGGCTTAATGG - Intergenic
1118345092 14:64933439-64933461 GAGGTTATAAACTGGCATTTAGG + Exonic
1118407894 14:65444903-65444925 GTTGTTATAAAAAGGGCTTGCGG + Intronic
1119631660 14:76237415-76237437 GGGGTTAGGAAAAGGCAGTAGGG - Intronic
1120682984 14:87503356-87503378 GTGGTTACTAAAAGGCTTTATGG - Intergenic
1123204460 14:106698983-106699005 AGGGTTAAGAAAAGGCATTAGGG + Intergenic
1123209466 14:106745454-106745476 AGGGTTAAGAAAAGGCATTAGGG + Intergenic
1123962532 15:25420595-25420617 ATGGGTGTAAAAAGTCATTATGG - Intronic
1125691240 15:41598008-41598030 GTGGCTAAGAAAAGGGATTACGG - Intergenic
1127787983 15:62372978-62373000 TAGGTTATAAAAAGGCACCATGG + Intergenic
1128105242 15:65039463-65039485 GTTTTTATCAAAACGCATTAAGG - Intergenic
1128627704 15:69227753-69227775 ATGGTTATAAAAGCACATTAAGG + Intronic
1129501912 15:76047597-76047619 GTGGTTACCAAAGGCCATTAAGG + Intronic
1139925886 16:70486194-70486216 GTGATTAGAAACAGGCATTCTGG - Intronic
1141162881 16:81640784-81640806 GTCGTTATAAAAAGGCCATGTGG - Intronic
1143603521 17:7966427-7966449 GTGTTTAAAATAAGGCATTTCGG + Intergenic
1147620176 17:41861257-41861279 GTGGTTATAGAAAGGAATAGGGG - Intronic
1150877665 17:68987473-68987495 GTAGTTAGGAAAAGGCATTTTGG + Intronic
1151910907 17:77082680-77082702 GTTGCTATAAAAAGGATTTAAGG + Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1154287649 18:13075151-13075173 GCTGTTATAAAAAGGCCTGAGGG + Intronic
1155401962 18:25448707-25448729 GTGTATATAAAGAGGCATTCAGG + Intergenic
1155993963 18:32310446-32310468 ATCTTTTTAAAAAGGCATTATGG + Intronic
1157052655 18:44185388-44185410 GGGGTGATAAAGAGGCATAATGG + Intergenic
1157253790 18:46119787-46119809 GTGTGTAAAAAAAGGCATAAAGG + Intronic
1157369120 18:47094092-47094114 GCCATTATAAAAAGGCATGATGG + Intronic
1157509665 18:48261796-48261818 GTGGTCATGGAAAGGCATTTTGG + Intronic
1157845032 18:50995360-50995382 TTGGTCATAAAAAGGAATAAAGG - Intronic
1159041667 18:63329254-63329276 GGGGTTTTAAAAAGGCAATATGG + Exonic
1159224767 18:65519300-65519322 GTGGTTTTAAACAGACACTAAGG + Intergenic
1164647530 19:29870600-29870622 GTGGATCAAAAAAGGAATTAAGG + Intergenic
925235040 2:2270673-2270695 GTGGCCATAAAAGGACATTAAGG + Intronic
926905969 2:17805973-17805995 GTGGCTATAAGAAGGTACTATGG + Intergenic
929856944 2:45645543-45645565 GTGGTTCTAAAGTGGCTTTAAGG + Intergenic
930329849 2:49968547-49968569 CTGCTTCTAAAATGGCATTACGG - Intronic
931101349 2:59004994-59005016 GAGGTCATAAAATGGCATTTAGG - Intergenic
931638138 2:64358975-64358997 GTGGTTCTGAGAAAGCATTATGG + Intergenic
931658717 2:64536158-64536180 GAGATTTTAAAAAGGCATTTGGG + Intronic
932763202 2:74453630-74453652 GTGATTATGAAAAGGGATTTTGG - Intergenic
933258114 2:80103424-80103446 GGGCTTATAAAAAGGTAATACGG - Intronic
933291231 2:80440687-80440709 GCAGTGAAAAAAAGGCATTACGG + Intronic
934636635 2:95995320-95995342 ATGCTTAGAAAAAGGCATGATGG + Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
936281727 2:111147070-111147092 GTAGTTTTAAAAAGTTATTATGG - Intronic
936545402 2:113388121-113388143 TTGCTTAGAAAAAGGCATGACGG - Intergenic
937038674 2:118803795-118803817 GTGGATATTAAAAGGCACTCGGG - Intergenic
937758913 2:125575914-125575936 GTGGTTATAAAAAGGTTATGCGG + Intergenic
939614777 2:144350093-144350115 ATGATTATTAAAAGGCATTCAGG + Intergenic
939908441 2:147949264-147949286 TTGGTAATAAAAAGGAATAAAGG + Intronic
940540919 2:155016161-155016183 GTGGTTATAAAAAACCTTTTTGG + Intergenic
940975625 2:159940252-159940274 GTGGTTATGAAAATGAAGTAAGG - Exonic
941107500 2:161373982-161374004 GTGGTTAAAAAAAAAAATTAGGG + Intronic
941597485 2:167495888-167495910 ATGTTTATTAAAAGGAATTATGG + Intergenic
942166548 2:173246289-173246311 TTGGTAATGAAAAGGCATTTGGG + Intronic
942888109 2:180953460-180953482 GGGATTATAAAAAGTCATGATGG + Intergenic
943065543 2:183082350-183082372 GTTGTTATAAAAATGGATGATGG + Intronic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
945674704 2:212841979-212842001 GTGGTTATAAAATGATTTTAAGG - Intergenic
945994275 2:216422697-216422719 GTGGTCAGAAAAAGGCATCATGG - Intronic
1170194887 20:13679902-13679924 GTGTTTATAAAAAGGCCTTTAGG - Intergenic
1170312304 20:15006005-15006027 GTGTTTATAATAAAGCATTTAGG - Intronic
1170464271 20:16608704-16608726 GTGGCTAGAAAAAGTCATGAGGG + Intergenic
1174101468 20:48129435-48129457 ATGGTTCCAAAAAGGGATTAAGG - Intergenic
1174779242 20:53372973-53372995 GTGGTTAGAAAAGGCCATTGTGG - Intronic
1177048697 21:16203940-16203962 GTGTTAATAAAAAGGTATTGGGG + Intergenic
1177160365 21:17540844-17540866 GTGGTTAAAAAAATTCAATAAGG - Intronic
1177689886 21:24492297-24492319 GTTGTTATAGTAAGCCATTATGG + Intergenic
1178229901 21:30770295-30770317 GTGTTTATAATAAGGGATTGTGG - Intergenic
1178633405 21:34281766-34281788 GTCCTTATAAAAAGAGATTAGGG + Intergenic
1178713652 21:34943549-34943571 GTTGTTATAGAAAGCCAATATGG + Intronic
1180911997 22:19457268-19457290 ATGGTTATAAAAAGACAACATGG - Intronic
1182249343 22:28987568-28987590 GGGGGTTTAGAAAGGCATTAAGG + Intronic
1184605250 22:45569337-45569359 GTTCTTATAAGAAGGGATTAGGG + Intronic
952594627 3:35001125-35001147 GTGGTTATAAAAAGACAATGAGG + Intergenic
954955372 3:54513971-54513993 GTGCATATAAACAGGCATGACGG - Intronic
955377311 3:58408820-58408842 GTGGTTATCAAGAGTCATTTCGG - Intronic
955802466 3:62700338-62700360 TTGGTCATAAAGAGGCATTTTGG + Intronic
955995234 3:64673594-64673616 ATGATTGTAAAAAGGCATTTTGG + Intronic
958541976 3:95489257-95489279 GGGGTTATAAGCAGGCAATAAGG + Intergenic
958686460 3:97404002-97404024 GAAGTTATAAAAAGGAATTATGG - Intronic
960760617 3:121070866-121070888 GTTGGTATATAATGGCATTAGGG + Intronic
961488920 3:127237576-127237598 GTGGAGTTAAAAAGGCATGAAGG + Intergenic
962724542 3:138210365-138210387 TTGGAGAAAAAAAGGCATTATGG - Intronic
963279597 3:143369786-143369808 TAGGTCATAAAAAGGCATTGTGG + Intronic
964440921 3:156708342-156708364 TTGGTTATAAAAAGTCACTAGGG + Intergenic
965043419 3:163541505-163541527 GTGGTTTTAAAAAATCATAAAGG - Intergenic
965606891 3:170506760-170506782 CTGGTTCTAAAAGGGCAATAGGG - Intronic
966158961 3:176948225-176948247 GTAGTTAATAAAAGGCATTGAGG - Intergenic
967625882 3:191683308-191683330 GTGGGAATAAAAAAGCATCAAGG - Intergenic
968543322 4:1179439-1179461 GTGGATAGAAAAAGGTACTATGG - Exonic
971522234 4:27568386-27568408 GTATTAATAAAAAGGCATTGTGG - Intergenic
971865053 4:32159192-32159214 GTGCTTATAAAAAGTCATTATGG - Intergenic
972321423 4:37976890-37976912 TTGATTATATAAAGGTATTAGGG + Intronic
974491982 4:62576247-62576269 GTGTTTACAAAAAGTCATTGTGG - Intergenic
974872322 4:67658860-67658882 GTAATTATAAAAAGGCCTGAGGG + Intronic
976333061 4:83853989-83854011 ATGGATATTAAATGGCATTATGG - Intergenic
976965563 4:91035980-91036002 GTGGTGGTAAAAAGTCATTTGGG + Intronic
977568478 4:98606801-98606823 TTGGTTCTATAAAGGCTTTACGG + Intronic
980418231 4:132521464-132521486 GTGGTTATACAAAGGCTTATGGG - Intergenic
980652938 4:135744466-135744488 GTGGTTACAATACGGCATTCTGG + Intergenic
982248096 4:153375453-153375475 GTGGTTACAAACAAGGATTATGG - Intronic
982514925 4:156333803-156333825 ATGGTTAAGAAAAGGCATTTAGG - Intergenic
982525481 4:156472523-156472545 GTGCTTATGTAAAGGCAATAGGG - Intergenic
984068785 4:175085332-175085354 GTGGGTTTAAAAAGGCTATATGG - Intergenic
986218282 5:5742082-5742104 GTCCTTATAAAAAGGAATTTTGG - Intergenic
990833917 5:59993026-59993048 ATTGTTAGAAAATGGCATTATGG + Intronic
992225622 5:74617456-74617478 GTGGTTCTACAATAGCATTATGG - Intergenic
994035019 5:95188699-95188721 GTGGTTATTAAAGGGCAATGCGG + Intronic
994798294 5:104335164-104335186 GTGTTTAAAAAAAGGAATAAGGG + Intergenic
994987264 5:106952493-106952515 GTTATTATAATCAGGCATTAAGG + Intergenic
997415561 5:133725634-133725656 GTGGTAATAAAACGTCATGATGG + Intergenic
997840531 5:137235422-137235444 GTGGTTGAAATAAGGCGTTAAGG - Intronic
999183477 5:149687867-149687889 GTGGTTATTAATAGCCATAAAGG - Intergenic
999196295 5:149783868-149783890 GTGGTTATAAAGGGGTATAAAGG - Intronic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1003036106 6:2641695-2641717 ATGGTTTTAAAAAGGCAAAAAGG - Intergenic
1005949580 6:30621641-30621663 TTGGTTATAAAAAGAGATTATGG + Intronic
1006093637 6:31642744-31642766 GTGGTTATATAATGGCAAGAAGG + Intronic
1006272552 6:32975157-32975179 GTGGTTAGAGAAAGGCAGCAGGG + Intronic
1007068073 6:39013548-39013570 GTGATTAGAAAAAGGCACAAAGG + Intronic
1008661237 6:53670468-53670490 TTGGTTGTACAAAGTCATTAAGG + Intergenic
1010138780 6:72587872-72587894 GTAGTTATAAAAGGGCAAAATGG - Intergenic
1011816687 6:91199575-91199597 GGGGTTATAAAAAAGTATAAGGG - Intergenic
1012466828 6:99524642-99524664 GGGGTTGTTGAAAGGCATTAAGG + Intergenic
1013016246 6:106163239-106163261 TTGGTTATAAAAAGGGAGTTTGG - Intergenic
1014130724 6:117829190-117829212 TTGGTTTTAAAAAGACATTTTGG - Intergenic
1015603261 6:134931140-134931162 GTTGTTTTAAAAAGGAAATAGGG - Intronic
1015672311 6:135704495-135704517 TTTTTTATAAAAAGGCATTTTGG + Intergenic
1016602351 6:145876839-145876861 GTCCTTATAAAAAGCCATCAGGG + Intronic
1016763927 6:147771420-147771442 CTGGTTATAAAAAGGAATGAAGG + Intergenic
1016768537 6:147822631-147822653 TTGGTTATAAGAAGTCATTTGGG + Intergenic
1017154856 6:151313988-151314010 ATTTTTATAAAAAGGCATAACGG - Intronic
1018251889 6:161879687-161879709 GGGTTTATAAAAGAGCATTATGG + Intronic
1019315785 7:385737-385759 GTGGTTATTAAAAGGCAGTGGGG + Intergenic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1021054859 7:16035115-16035137 GAGGTTATAAAAAGAAATGAGGG - Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1023655272 7:42413442-42413464 GTAGTTTTAAAAAGCCAATATGG + Intergenic
1025907455 7:65798840-65798862 GTGGTTAAAAAAAGGCAGACTGG + Intergenic
1026408646 7:70095476-70095498 GTGGTAATGAATGGGCATTAAGG + Intronic
1027459102 7:78429972-78429994 GTGGTTAGGAAAAGGGATTCTGG - Intronic
1027552776 7:79619704-79619726 GTGGTTTTAATAAAGCATCAAGG + Intergenic
1028496242 7:91463963-91463985 GAGTTTAAAAAAAGGCATTAGGG + Intergenic
1028865128 7:95700608-95700630 GTAGATATAAAAAGATATTAAGG - Intergenic
1031326022 7:120398974-120398996 GTGATTTAAAAAAGGCTTTATGG - Intronic
1031895073 7:127338958-127338980 GGGGATAGAAAAATGCATTATGG - Intergenic
1036450360 8:8860939-8860961 GTGATTATAATAAGGTATTTGGG - Intronic
1036606285 8:10308493-10308515 GTGTTTTTAACAGGGCATTATGG - Intronic
1037218053 8:16482431-16482453 GTGGTTATAGAAATGGACTAGGG - Intronic
1037668490 8:20994352-20994374 GTGTCTATACAAAGGCATGATGG + Intergenic
1041186834 8:55309442-55309464 GTCATTATAAAAGGGCAATATGG + Intronic
1042565383 8:70105209-70105231 GCCTTTATAAAAAGGCATTTGGG + Intergenic
1042940116 8:74098966-74098988 GTGGTTATAAAAATGTTTTCAGG - Intergenic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1044208390 8:89519611-89519633 GTGGTTATAGAAATGTATTCAGG + Intergenic
1044211930 8:89560717-89560739 TGGGTTAGAAGAAGGCATTATGG + Intergenic
1045641560 8:104257207-104257229 CTGGTACTCAAAAGGCATTAAGG - Intergenic
1046882613 8:119326542-119326564 GGGATTATAAAAATGCCTTATGG + Intergenic
1048014734 8:130487104-130487126 GTGGTAATAAAATGTGATTAAGG + Intergenic
1050728273 9:8677012-8677034 TTAGTTATAAAAAGCCATAATGG + Intronic
1051572468 9:18575548-18575570 GTGGTAATGAAATGGAATTAGGG + Intronic
1051903137 9:22064294-22064316 GTGGTCCTAAAGTGGCATTAAGG + Intergenic
1057462189 9:95273056-95273078 GAGGTTATATGAAGGAATTAAGG + Intronic
1059078213 9:111217918-111217940 GGGGGTATAAAAAGTCATTAGGG - Intergenic
1059150486 9:111945233-111945255 ATGGTCATAGCAAGGCATTAGGG - Intergenic
1059816977 9:117927600-117927622 GTGGTCAAAAAAACCCATTAGGG - Intergenic
1060085746 9:120699328-120699350 GTGATTTTAAAAAAGCTTTATGG + Intronic
1060124137 9:121025273-121025295 ATAGTTATAAAAAGGCAGTAGGG - Intronic
1061597183 9:131638906-131638928 TTGCTTATTAAAAGGCAGTATGG - Intronic
1186256234 X:7723757-7723779 GTCGTTTTAAAAAGCCATTAAGG + Intergenic
1187321481 X:18242387-18242409 GAGGTCATTCAAAGGCATTACGG + Intronic
1188334239 X:28909495-28909517 ATGTTTATAAAAAGGAAATAAGG - Intronic
1188816247 X:34718368-34718390 ATGGTGATAGAAAGGCATCATGG - Intergenic
1188880631 X:35487483-35487505 GTGGTTATAACAACATATTAGGG + Intergenic
1191646905 X:63492072-63492094 GTGATGAAAAAAAGACATTAGGG + Intergenic
1194739118 X:97551102-97551124 GTGATTTTAAAAAGCCATTAAGG + Intronic
1197428022 X:126322921-126322943 GTGGTTATAAAGTGGTATTTTGG + Intergenic
1199750569 X:150813109-150813131 GTGGTTATAAAATGTAATCATGG + Intronic
1199785760 X:151103449-151103471 GTGGTTATAACCAAGAATTATGG - Intergenic