ID: 936104903

View in Genome Browser
Species Human (GRCh38)
Location 2:109615068-109615090
Sequence GGGGGCTACCGCACAGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936104888_936104903 22 Left 936104888 2:109615023-109615045 CCCGCCACATGGCTGCGAGGAGG 0: 1
1: 0
2: 1
3: 19
4: 194
Right 936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 109
936104890_936104903 21 Left 936104890 2:109615024-109615046 CCGCCACATGGCTGCGAGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 208
Right 936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 109
936104892_936104903 18 Left 936104892 2:109615027-109615049 CCACATGGCTGCGAGGAGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 136
Right 936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936104903 Original CRISPR GGGGGCTACCGCACAGAGGC CGG Exonic
900216030 1:1482120-1482142 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900223149 1:1520123-1520145 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900592766 1:3467356-3467378 TGAGGCTGCCCCACAGAGGCAGG + Intronic
902361304 1:15943917-15943939 GGGGGCCACCCCACAGAGCTCGG + Intronic
902692086 1:18116307-18116329 GGTGGCTGCCCCACAGAGACAGG - Intronic
902971564 1:20056216-20056238 GGGAGCTACCGCAGTGGGGCAGG - Intronic
915163713 1:153936621-153936643 GGTGCCGACCGCACATAGGCAGG + Exonic
915816537 1:158973023-158973045 GGGTGCTGTGGCACAGAGGCAGG - Intronic
916472842 1:165140772-165140794 GGGTGGGACAGCACAGAGGCAGG - Intergenic
920385268 1:205567121-205567143 GGGGGCTACCTCATTGTGGCAGG + Intergenic
922612432 1:226940328-226940350 GGTGGCCAGCGCGCAGAGGCGGG + Intronic
923025107 1:230197527-230197549 GGGGGTTACATCAGAGAGGCAGG + Intronic
1066746074 10:38604808-38604830 GGGGGCTATTCCACAGTGGCTGG + Intergenic
1074740285 10:116479780-116479802 GGAGGCCACTGCACAGAGGCAGG - Intergenic
1076706973 10:132307593-132307615 GGCGGCCACCGCGCGGAGGCCGG - Exonic
1078348480 11:10572934-10572956 ATGGGCTACCTCACAGGGGCTGG - Intronic
1078458715 11:11496606-11496628 AAGGGCTACCACACAGAGGGTGG + Intronic
1080604724 11:33855513-33855535 GGGGGCTACCTGGAAGAGGCGGG + Intergenic
1084041196 11:66543669-66543691 GGAGGCCTCTGCACAGAGGCAGG - Intronic
1086874834 11:92083106-92083128 GGGGGCAACAACACAGAGGAAGG + Intergenic
1089323988 11:117644767-117644789 GGAGTCTACCGCACAGGGGCTGG - Intronic
1089709984 11:120307643-120307665 GTGGGCTACCTCACACAGGTAGG + Intronic
1089904480 11:122024435-122024457 GGGGGCTTTTGCACAGAGCCAGG - Intergenic
1090390354 11:126383782-126383804 AGGGGCTACTGCGCAGAGCCTGG + Intronic
1091259726 11:134224772-134224794 GGGGGCAGCCGCACAGAGCCGGG - Exonic
1091842489 12:3630954-3630976 AGCGGCTACAGCACAGTGGCAGG - Intronic
1096686827 12:53293457-53293479 TGGGGTTACCGCAGAGAGACAGG - Exonic
1113799664 13:113079869-113079891 AGGGGCATCCGCACAGAGGAGGG + Intronic
1113799702 13:113080029-113080051 GGGGGCATCCGCACAGAGGAGGG + Intronic
1113799738 13:113080189-113080211 GGGGGCATCCGCACAGAGGAGGG + Intronic
1122721122 14:103723245-103723267 AGGGGCCACCACACAGAGGCAGG + Intronic
1122747975 14:103910954-103910976 GAGGGCTTCCCCACAAAGGCTGG - Intergenic
1123048113 14:105528151-105528173 GGGGGCTGCCGGGCAGGGGCGGG + Intronic
1129304369 15:74648340-74648362 GGCAGCTACGGCTCAGAGGCAGG + Intronic
1132116338 15:99138854-99138876 AGGGCCTACCTCACAGAGCCTGG - Intronic
1132899322 16:2244673-2244695 GGGTGCTGCCCCACAGAGCCAGG + Intronic
1134596809 16:15502325-15502347 TGGGGCGACCTCACAGAGACGGG + Intronic
1137669439 16:50270912-50270934 GGGGGCCACTGCACAGATGAGGG - Intronic
1141028945 16:80571335-80571357 GGGGTCTCCAGCCCAGAGGCAGG - Intergenic
1141873898 16:86808479-86808501 GGGGGCTAGCCCACAGAGCATGG + Intergenic
1143031871 17:3972527-3972549 GGGGGCTCAGGCCCAGAGGCGGG - Intergenic
1143679778 17:8467678-8467700 GGAGGAGACAGCACAGAGGCTGG - Exonic
1145249654 17:21290133-21290155 GGGGGCTGCCTCACTGGGGCAGG + Intronic
1148770680 17:50064251-50064273 GGGGGGTACCGCAGAGAGAATGG + Intronic
1152285725 17:79411567-79411589 GGGGCTTACAGCACAGAGGGAGG - Intronic
1154348574 18:13564683-13564705 GGGGGCGGCAGCGCAGAGGCGGG - Intronic
1155054221 18:22170650-22170672 AGGGGCATCCGCAGAGAGGCGGG + Intronic
1157319875 18:46625840-46625862 GGGGTCTTCCGTAGAGAGGCAGG - Intronic
1157381390 18:47221534-47221556 AGGGGCAAAGGCACAGAGGCTGG - Intronic
1160383931 18:78482572-78482594 GGGAGCTACAGGACAGTGGCAGG + Intergenic
1160470615 18:79129433-79129455 TGAGGCTGCCGCACAGAGCCAGG + Intronic
1160823182 19:1067631-1067653 AGGGGCCACAGCAGAGAGGCCGG + Intronic
1161652862 19:5496130-5496152 GGGGGGTACAGGAGAGAGGCTGG + Intergenic
1161736939 19:5997216-5997238 GGGGACAAGCGGACAGAGGCTGG + Intronic
1162459038 19:10803425-10803447 GGGGGCTGCCACCCACAGGCAGG - Intronic
1165007717 19:32820091-32820113 GTGGGCGACTGCACAGAGCCTGG + Intronic
1166107819 19:40606035-40606057 GGGGGCCAAGGCACAAAGGCAGG - Intronic
1166546898 19:43639518-43639540 GGGGGCTGCGGCACGGCGGCCGG + Intronic
1166892308 19:46000946-46000968 GGAGGAGACCGCACAGAGGAAGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
926832244 2:16976316-16976338 GGGGGATAAGGCACAGAGGCTGG + Intergenic
927880062 2:26684023-26684045 GCGGGCTGGAGCACAGAGGCAGG - Intergenic
928442530 2:31304014-31304036 GGGGGCCACAGCTCAGAGACAGG + Intergenic
930771511 2:55134713-55134735 GGGGGCTGCAGGTCAGAGGCTGG - Intergenic
932734541 2:74245473-74245495 TGGGGCTTCCCCACAGAGGCAGG + Intronic
935637531 2:105261238-105261260 GTGGGCAACCAGACAGAGGCAGG + Intergenic
936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG + Exonic
937368376 2:121281312-121281334 GGGGGCTCCTGCACAGAGCCAGG + Intronic
938408763 2:131046872-131046894 TGGAGCTACCGCACAGCAGCAGG - Exonic
939986415 2:148833594-148833616 TGGGGCTGCTGCAGAGAGGCAGG + Intergenic
940018296 2:149130035-149130057 GGGGCCTACCAGAAAGAGGCGGG - Intronic
940424534 2:153515280-153515302 GGGAGCTACGGCAGAGAGGTGGG - Intergenic
943137442 2:183932388-183932410 TGGGGCTATGGCACAGAGGTAGG + Intergenic
945984164 2:216340807-216340829 GGGGGCCACAGAATAGAGGCTGG + Intronic
948601768 2:239111549-239111571 GGGGGCTCCTGCACAGACACGGG + Exonic
948661160 2:239507270-239507292 GGGGTCTAGGCCACAGAGGCCGG + Intergenic
1169553269 20:6723329-6723351 GGGTGCTAACCCACAGAGCCAGG + Intergenic
1172040662 20:32042515-32042537 GGGAGCAAAGGCACAGAGGCTGG - Intergenic
1173808445 20:45941211-45941233 GGAGGCTGCAGCCCAGAGGCAGG - Intronic
1181634540 22:24168500-24168522 TGGGGCTGCCGCCCAGAGACAGG + Exonic
1181852081 22:25756619-25756641 GGGGGCTTCAGCACAGCAGCAGG + Intronic
1182003817 22:26942498-26942520 TGGGGCTACCGTAAAGAGCCTGG - Intergenic
1182289913 22:29268850-29268872 CGGGGCTCCCGCTCATAGGCCGG - Intronic
1183104508 22:35606566-35606588 CTGGGCCACCGCTCAGAGGCAGG - Intergenic
1183492799 22:38125787-38125809 GGTGGCGACAGCACAGTGGCTGG + Intronic
1185219552 22:49622597-49622619 GGGGCCTGCCCCACAGAGGTGGG + Intronic
1185398446 22:50604206-50604228 GGGGGCTCCGGCTCCGAGGCGGG - Exonic
950534687 3:13571980-13572002 GGGGCCTACCGGGCTGAGGCAGG - Intronic
950620966 3:14204946-14204968 GGGGGCAACTGACCAGAGGCAGG - Intergenic
961817356 3:129558059-129558081 AGGGGCTACTGCCCAGAGCCTGG + Intronic
967374091 3:188781599-188781621 GTGAGCGACCGCACCGAGGCAGG - Intronic
967841632 3:194009590-194009612 GGGGGCAGCACCACAGAGGCGGG - Intergenic
968920100 4:3518033-3518055 CAGGGCTACAGCACTGAGGCTGG - Exonic
969445917 4:7244663-7244685 AGGGGCAACCGCACAGAGTGGGG - Intronic
969628972 4:8324343-8324365 GGGGGGTGACTCACAGAGGCAGG - Intergenic
998199612 5:140108656-140108678 GGGGGGAACCGAACAGAGGAGGG - Intronic
1000068373 5:157716722-157716744 TGGTGCCACCGCACAGAGACAGG - Intergenic
1001030588 5:168259689-168259711 TGGGGCCACTGCACTGAGGCTGG - Intronic
1002093555 5:176818075-176818097 CTGGGCTACAGCACGGAGGCGGG - Intronic
1002097286 5:176839047-176839069 AGGTGCAAACGCACAGAGGCAGG - Intronic
1003251919 6:4436240-4436262 GGTGGGTAGAGCACAGAGGCTGG + Intergenic
1004570619 6:16841085-16841107 AGGGGCTACCTCTCTGAGGCTGG + Intergenic
1006398152 6:33800465-33800487 GGGAGCCAGCGCCCAGAGGCGGG - Intronic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1015440327 6:133240919-133240941 GGGGGCTGCCCCACAGAAGCAGG + Intronic
1019649958 7:2151526-2151548 GGAGGCTTCCCCACAGAGGGAGG - Intronic
1032240066 7:130153454-130153476 GGGGGCAGCCGCGGAGAGGCTGG + Intergenic
1035023057 7:155809954-155809976 GGGGGCGCCCGCGCAGGGGCCGG - Intronic
1037968140 8:23149662-23149684 GGGGGATACCGAGCAGAGACGGG - Intronic
1039891142 8:41686336-41686358 GGGGCCTCCAGCACACAGGCTGG + Intronic
1040851394 8:51904421-51904443 GGGGGCACCCGCACAGCTGCAGG - Intergenic
1041510774 8:58652670-58652692 GGGGGGTACCTCACAGAGAAAGG - Intronic
1041658422 8:60376885-60376907 GGTGGCCCCAGCACAGAGGCAGG + Intergenic
1047178999 8:122569251-122569273 GGGGGCTTCCACAGAGAAGCTGG + Intergenic
1049593272 8:143472141-143472163 AGGGTCTGGCGCACAGAGGCTGG - Intronic
1049620674 8:143597164-143597186 TGGGGCGAGCGCAGAGAGGCGGG - Intronic
1049896241 9:113910-113932 GGGGGCGGCGGCGCAGAGGCCGG + Intergenic
1061090387 9:128422724-128422746 GTGTGCTACAGCAGAGAGGCTGG - Intronic
1062656642 9:137607087-137607109 TGGTCCTACCTCACAGAGGCTGG + Intronic
1187467876 X:19542590-19542612 GGGGACAACTGCACAGAGGGAGG + Intronic