ID: 936110480

View in Genome Browser
Species Human (GRCh38)
Location 2:109660572-109660594
Sequence ACTACTTGATGCCTCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936110480_936110483 -1 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110483 2:109660594-109660616 TCCCCATGCCAGGAGGCAGATGG No data
936110480_936110482 -8 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110482 2:109660587-109660609 CAAGTAGTCCCCATGCCAGGAGG No data
936110480_936110487 1 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110487 2:109660596-109660618 CCCATGCCAGGAGGCAGATGGGG No data
936110480_936110491 10 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110491 2:109660605-109660627 GGAGGCAGATGGGGGACTGCTGG No data
936110480_936110485 0 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110485 2:109660595-109660617 CCCCATGCCAGGAGGCAGATGGG No data
936110480_936110489 2 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110489 2:109660597-109660619 CCATGCCAGGAGGCAGATGGGGG No data
936110480_936110492 26 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110492 2:109660621-109660643 CTGCTGGATGAGTAGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936110480 Original CRISPR ACTACTTGATGCCTCCCTGT AGG (reversed) Intergenic