ID: 936110489

View in Genome Browser
Species Human (GRCh38)
Location 2:109660597-109660619
Sequence CCATGCCAGGAGGCAGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936110480_936110489 2 Left 936110480 2:109660572-109660594 CCTACAGGGAGGCATCAAGTAGT No data
Right 936110489 2:109660597-109660619 CCATGCCAGGAGGCAGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936110489 Original CRISPR CCATGCCAGGAGGCAGATGG GGG Intergenic