ID: 936111768

View in Genome Browser
Species Human (GRCh38)
Location 2:109670879-109670901
Sequence GGCTGCACTCCTTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936111768_936111782 15 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111782 2:109670917-109670939 GTTCCTGTGGCTTGGGGAGCTGG No data
936111768_936111774 -7 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111774 2:109670895-109670917 TGCAGCCTCAGTGGGCCCAGTGG No data
936111768_936111777 7 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111777 2:109670909-109670931 GCCCAGTGGTTCCTGTGGCTTGG No data
936111768_936111779 8 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111779 2:109670910-109670932 CCCAGTGGTTCCTGTGGCTTGGG No data
936111768_936111785 24 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111785 2:109670926-109670948 GCTTGGGGAGCTGGGCACTATGG No data
936111768_936111781 9 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111781 2:109670911-109670933 CCAGTGGTTCCTGTGGCTTGGGG No data
936111768_936111776 2 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111776 2:109670904-109670926 AGTGGGCCCAGTGGTTCCTGTGG No data
936111768_936111783 16 Left 936111768 2:109670879-109670901 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 936111783 2:109670918-109670940 TTCCTGTGGCTTGGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936111768 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr