ID: 936111827

View in Genome Browser
Species Human (GRCh38)
Location 2:109671135-109671157
Sequence CTGGTAGGAAGCAGCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936111827_936111836 10 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111836 2:109671168-109671190 ATCCACCTGCTGGATATTGGAGG No data
936111827_936111838 14 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111838 2:109671172-109671194 ACCTGCTGGATATTGGAGGCTGG No data
936111827_936111841 21 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111841 2:109671179-109671201 GGATATTGGAGGCTGGAGGCTGG No data
936111827_936111835 7 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111835 2:109671165-109671187 AGGATCCACCTGCTGGATATTGG No data
936111827_936111834 0 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111834 2:109671158-109671180 GAGAAGGAGGATCCACCTGCTGG No data
936111827_936111840 17 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111840 2:109671175-109671197 TGCTGGATATTGGAGGCTGGAGG No data
936111827_936111842 30 Left 936111827 2:109671135-109671157 CCCACACTGCTGCTTCCTACCAG No data
Right 936111842 2:109671188-109671210 AGGCTGGAGGCTGGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936111827 Original CRISPR CTGGTAGGAAGCAGCAGTGT GGG (reversed) Intergenic
No off target data available for this crispr