ID: 936111921

View in Genome Browser
Species Human (GRCh38)
Location 2:109671545-109671567
Sequence CTTCTCCTGGAGAATCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936111912_936111921 1 Left 936111912 2:109671521-109671543 CCAGGGCAAGGAGGAGTCCTCCC No data
Right 936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG No data
936111906_936111921 25 Left 936111906 2:109671497-109671519 CCATGGGCCTCATTGGAGGTGCA No data
Right 936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG No data
936111908_936111921 18 Left 936111908 2:109671504-109671526 CCTCATTGGAGGTGCAGCCAGGG No data
Right 936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936111921 Original CRISPR CTTCTCCTGGAGAATCTGGA GGG Intergenic
No off target data available for this crispr