ID: 936112580

View in Genome Browser
Species Human (GRCh38)
Location 2:109677117-109677139
Sequence AAACTCCCACAGGAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936112580_936112591 29 Left 936112580 2:109677117-109677139 CCTGTCTCCTCCTGTGGGAGTTT No data
Right 936112591 2:109677169-109677191 CCCTGCCTCCCAGGTAGAACTGG No data
936112580_936112585 -1 Left 936112580 2:109677117-109677139 CCTGTCTCCTCCTGTGGGAGTTT No data
Right 936112585 2:109677139-109677161 TACTTGGCATCACCTCCTCTGGG No data
936112580_936112584 -2 Left 936112580 2:109677117-109677139 CCTGTCTCCTCCTGTGGGAGTTT No data
Right 936112584 2:109677138-109677160 TTACTTGGCATCACCTCCTCTGG No data
936112580_936112588 20 Left 936112580 2:109677117-109677139 CCTGTCTCCTCCTGTGGGAGTTT No data
Right 936112588 2:109677160-109677182 GGCACCTTTCCCTGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936112580 Original CRISPR AAACTCCCACAGGAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr