ID: 936113173

View in Genome Browser
Species Human (GRCh38)
Location 2:109681831-109681853
Sequence GCTGAGCGGGAAGAGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113173_936113183 30 Left 936113173 2:109681831-109681853 CCAAGAGGCTCTTCCCGCTCAGC No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113173_936113182 20 Left 936113173 2:109681831-109681853 CCAAGAGGCTCTTCCCGCTCAGC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data
936113173_936113177 -3 Left 936113173 2:109681831-109681853 CCAAGAGGCTCTTCCCGCTCAGC No data
Right 936113177 2:109681851-109681873 AGCGGAGACCAAACTCCCTGTGG No data
936113173_936113178 -2 Left 936113173 2:109681831-109681853 CCAAGAGGCTCTTCCCGCTCAGC No data
Right 936113178 2:109681852-109681874 GCGGAGACCAAACTCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113173 Original CRISPR GCTGAGCGGGAAGAGCCTCT TGG (reversed) Intergenic
No off target data available for this crispr