ID: 936113179

View in Genome Browser
Species Human (GRCh38)
Location 2:109681859-109681881
Sequence GATCAGTCCCACAGGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113179_936113182 -8 Left 936113179 2:109681859-109681881 CCAAACTCCCTGTGGGACTGATC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data
936113179_936113184 5 Left 936113179 2:109681859-109681881 CCAAACTCCCTGTGGGACTGATC No data
Right 936113184 2:109681887-109681909 TGTTCTCTGGAGTAGAGAGGTGG No data
936113179_936113183 2 Left 936113179 2:109681859-109681881 CCAAACTCCCTGTGGGACTGATC No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113179 Original CRISPR GATCAGTCCCACAGGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr