ID: 936113180

View in Genome Browser
Species Human (GRCh38)
Location 2:109681866-109681888
Sequence CACAGTAGATCAGTCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113180_936113183 -5 Left 936113180 2:109681866-109681888 CCCTGTGGGACTGATCTACTGTG No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113180_936113184 -2 Left 936113180 2:109681866-109681888 CCCTGTGGGACTGATCTACTGTG No data
Right 936113184 2:109681887-109681909 TGTTCTCTGGAGTAGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113180 Original CRISPR CACAGTAGATCAGTCCCACA GGG (reversed) Intergenic
No off target data available for this crispr