ID: 936113182

View in Genome Browser
Species Human (GRCh38)
Location 2:109681874-109681896
Sequence GACTGATCTACTGTGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113173_936113182 20 Left 936113173 2:109681831-109681853 CCAAGAGGCTCTTCCCGCTCAGC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data
936113179_936113182 -8 Left 936113179 2:109681859-109681881 CCAAACTCCCTGTGGGACTGATC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data
936113176_936113182 6 Left 936113176 2:109681845-109681867 CCGCTCAGCGGAGACCAAACTCC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data
936113175_936113182 7 Left 936113175 2:109681844-109681866 CCCGCTCAGCGGAGACCAAACTC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data
936113172_936113182 27 Left 936113172 2:109681824-109681846 CCATGGGCCAAGAGGCTCTTCCC No data
Right 936113182 2:109681874-109681896 GACTGATCTACTGTGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113182 Original CRISPR GACTGATCTACTGTGTTCTC TGG Intergenic
No off target data available for this crispr