ID: 936113183

View in Genome Browser
Species Human (GRCh38)
Location 2:109681884-109681906
Sequence CTGTGTTCTCTGGAGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113180_936113183 -5 Left 936113180 2:109681866-109681888 CCCTGTGGGACTGATCTACTGTG No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113173_936113183 30 Left 936113173 2:109681831-109681853 CCAAGAGGCTCTTCCCGCTCAGC No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113179_936113183 2 Left 936113179 2:109681859-109681881 CCAAACTCCCTGTGGGACTGATC No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113181_936113183 -6 Left 936113181 2:109681867-109681889 CCTGTGGGACTGATCTACTGTGT No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113176_936113183 16 Left 936113176 2:109681845-109681867 CCGCTCAGCGGAGACCAAACTCC No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data
936113175_936113183 17 Left 936113175 2:109681844-109681866 CCCGCTCAGCGGAGACCAAACTC No data
Right 936113183 2:109681884-109681906 CTGTGTTCTCTGGAGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113183 Original CRISPR CTGTGTTCTCTGGAGTAGAG AGG Intergenic
No off target data available for this crispr