ID: 936113808

View in Genome Browser
Species Human (GRCh38)
Location 2:109686217-109686239
Sequence CTTCCAGTGGCCACGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113808_936113815 -7 Left 936113808 2:109686217-109686239 CCTGAGCCCGTGGCCACTGGAAG No data
Right 936113815 2:109686233-109686255 CTGGAAGTTCTACGGGAGGCTGG No data
936113808_936113817 14 Left 936113808 2:109686217-109686239 CCTGAGCCCGTGGCCACTGGAAG No data
Right 936113817 2:109686254-109686276 GGACACTTCTTAGGTTAAACTGG No data
936113808_936113816 5 Left 936113808 2:109686217-109686239 CCTGAGCCCGTGGCCACTGGAAG No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113808 Original CRISPR CTTCCAGTGGCCACGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr