ID: 936113810

View in Genome Browser
Species Human (GRCh38)
Location 2:109686224-109686246
Sequence CGTAGAACTTCCAGTGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113810_936113816 -2 Left 936113810 2:109686224-109686246 CCGTGGCCACTGGAAGTTCTACG No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data
936113810_936113817 7 Left 936113810 2:109686224-109686246 CCGTGGCCACTGGAAGTTCTACG No data
Right 936113817 2:109686254-109686276 GGACACTTCTTAGGTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113810 Original CRISPR CGTAGAACTTCCAGTGGCCA CGG (reversed) Intergenic
No off target data available for this crispr