ID: 936113815

View in Genome Browser
Species Human (GRCh38)
Location 2:109686233-109686255
Sequence CTGGAAGTTCTACGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113808_936113815 -7 Left 936113808 2:109686217-109686239 CCTGAGCCCGTGGCCACTGGAAG No data
Right 936113815 2:109686233-109686255 CTGGAAGTTCTACGGGAGGCTGG No data
936113807_936113815 -6 Left 936113807 2:109686216-109686238 CCCTGAGCCCGTGGCCACTGGAA No data
Right 936113815 2:109686233-109686255 CTGGAAGTTCTACGGGAGGCTGG No data
936113804_936113815 21 Left 936113804 2:109686189-109686211 CCTGGGTTTGTGTTGAAGCAAGT No data
Right 936113815 2:109686233-109686255 CTGGAAGTTCTACGGGAGGCTGG No data
936113803_936113815 22 Left 936113803 2:109686188-109686210 CCCTGGGTTTGTGTTGAAGCAAG No data
Right 936113815 2:109686233-109686255 CTGGAAGTTCTACGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113815 Original CRISPR CTGGAAGTTCTACGGGAGGC TGG Intergenic
No off target data available for this crispr