ID: 936113816

View in Genome Browser
Species Human (GRCh38)
Location 2:109686245-109686267
Sequence CGGGAGGCTGGACACTTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936113809_936113816 -1 Left 936113809 2:109686223-109686245 CCCGTGGCCACTGGAAGTTCTAC No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data
936113814_936113816 -8 Left 936113814 2:109686230-109686252 CCACTGGAAGTTCTACGGGAGGC No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data
936113807_936113816 6 Left 936113807 2:109686216-109686238 CCCTGAGCCCGTGGCCACTGGAA No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data
936113808_936113816 5 Left 936113808 2:109686217-109686239 CCTGAGCCCGTGGCCACTGGAAG No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data
936113810_936113816 -2 Left 936113810 2:109686224-109686246 CCGTGGCCACTGGAAGTTCTACG No data
Right 936113816 2:109686245-109686267 CGGGAGGCTGGACACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936113816 Original CRISPR CGGGAGGCTGGACACTTCTT AGG Intergenic
No off target data available for this crispr