ID: 936116041

View in Genome Browser
Species Human (GRCh38)
Location 2:109704020-109704042
Sequence CTACCTAGGCTGAGGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936116034_936116041 3 Left 936116034 2:109703994-109704016 CCAATCACTTCTCACACTGAGGG No data
Right 936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG No data
936116031_936116041 10 Left 936116031 2:109703987-109704009 CCCACTGCCAATCACTTCTCACA No data
Right 936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG No data
936116032_936116041 9 Left 936116032 2:109703988-109704010 CCACTGCCAATCACTTCTCACAC No data
Right 936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG No data
936116030_936116041 22 Left 936116030 2:109703975-109703997 CCAATCACTTCTCCCACTGCCAA No data
Right 936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936116041 Original CRISPR CTACCTAGGCTGAGGGTGGT GGG Intergenic
No off target data available for this crispr