ID: 936125578

View in Genome Browser
Species Human (GRCh38)
Location 2:109787009-109787031
Sequence ATGCCCTTCTGGAAAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936125574_936125578 22 Left 936125574 2:109786964-109786986 CCAAGTGAGAGTGGTGGAGAGAA No data
Right 936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936125578 Original CRISPR ATGCCCTTCTGGAAAGGTGA AGG Intergenic
No off target data available for this crispr