ID: 936126004

View in Genome Browser
Species Human (GRCh38)
Location 2:109789692-109789714
Sequence CACTGAACTCAGGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936126004_936126017 29 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126017 2:109789744-109789766 CAGGATGGCCCTGGCACCAGCGG No data
936126004_936126010 1 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126010 2:109789716-109789738 TGGGGAATGTGAGGACACAATGG No data
936126004_936126016 20 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126016 2:109789735-109789757 ATGGCGGGGCAGGATGGCCCTGG No data
936126004_936126011 4 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126011 2:109789719-109789741 GGAATGTGAGGACACAATGGCGG No data
936126004_936126013 6 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126013 2:109789721-109789743 AATGTGAGGACACAATGGCGGGG No data
936126004_936126009 -8 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126009 2:109789707-109789729 GTTCAGTGTTGGGGAATGTGAGG No data
936126004_936126014 10 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126014 2:109789725-109789747 TGAGGACACAATGGCGGGGCAGG No data
936126004_936126015 14 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126015 2:109789729-109789751 GACACAATGGCGGGGCAGGATGG No data
936126004_936126012 5 Left 936126004 2:109789692-109789714 CCAGGGGAAACCTGAGTTCAGTG No data
Right 936126012 2:109789720-109789742 GAATGTGAGGACACAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936126004 Original CRISPR CACTGAACTCAGGTTTCCCC TGG (reversed) Intergenic