ID: 936146052

View in Genome Browser
Species Human (GRCh38)
Location 2:109981271-109981293
Sequence CCTTCTGAGCAGAGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146052_936146059 14 Left 936146052 2:109981271-109981293 CCTGCCTCTCTCTGCTCAGAAGG No data
Right 936146059 2:109981308-109981330 AAAGCATTTTCTAAGAACCTTGG No data
936146052_936146061 25 Left 936146052 2:109981271-109981293 CCTGCCTCTCTCTGCTCAGAAGG No data
Right 936146061 2:109981319-109981341 TAAGAACCTTGGAGCACAGTGGG No data
936146052_936146060 24 Left 936146052 2:109981271-109981293 CCTGCCTCTCTCTGCTCAGAAGG No data
Right 936146060 2:109981318-109981340 CTAAGAACCTTGGAGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146052 Original CRISPR CCTTCTGAGCAGAGAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr