ID: 936146104

View in Genome Browser
Species Human (GRCh38)
Location 2:109981523-109981545
Sequence CACGGCAGTCAGGGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146104_936146112 -4 Left 936146104 2:109981523-109981545 CCTGCTTTCCCCTGACTGCCGTG No data
Right 936146112 2:109981542-109981564 CGTGGAGGTGGTACCAGACCAGG No data
936146104_936146115 8 Left 936146104 2:109981523-109981545 CCTGCTTTCCCCTGACTGCCGTG No data
Right 936146115 2:109981554-109981576 ACCAGACCAGGCTGACCCAGGGG No data
936146104_936146119 17 Left 936146104 2:109981523-109981545 CCTGCTTTCCCCTGACTGCCGTG No data
Right 936146119 2:109981563-109981585 GGCTGACCCAGGGGACCTTAGGG No data
936146104_936146114 7 Left 936146104 2:109981523-109981545 CCTGCTTTCCCCTGACTGCCGTG No data
Right 936146114 2:109981553-109981575 TACCAGACCAGGCTGACCCAGGG No data
936146104_936146118 16 Left 936146104 2:109981523-109981545 CCTGCTTTCCCCTGACTGCCGTG No data
Right 936146118 2:109981562-109981584 AGGCTGACCCAGGGGACCTTAGG No data
936146104_936146113 6 Left 936146104 2:109981523-109981545 CCTGCTTTCCCCTGACTGCCGTG No data
Right 936146113 2:109981552-109981574 GTACCAGACCAGGCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146104 Original CRISPR CACGGCAGTCAGGGGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr