ID: 936146944

View in Genome Browser
Species Human (GRCh38)
Location 2:109986633-109986655
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146944_936146960 19 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146944_936146962 22 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data
936146944_936146963 27 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146944_936146952 2 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146944_936146956 6 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146944 Original CRISPR GCCTGGGACTGGTTAGGGAT CGG (reversed) Intergenic