ID: 936146945

View in Genome Browser
Species Human (GRCh38)
Location 2:109986638-109986660
Sequence GCTGGGCCTGGGACTGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146945_936146956 1 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146945_936146964 29 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data
936146945_936146960 14 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146945_936146952 -3 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146945_936146963 22 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146945_936146962 17 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146945 Original CRISPR GCTGGGCCTGGGACTGGTTA GGG (reversed) Intergenic
No off target data available for this crispr