ID: 936146946

View in Genome Browser
Species Human (GRCh38)
Location 2:109986639-109986661
Sequence GGCTGGGCCTGGGACTGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146946_936146952 -4 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146946_936146962 16 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data
936146946_936146964 28 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data
936146946_936146963 21 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146946_936146956 0 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146946_936146960 13 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146946 Original CRISPR GGCTGGGCCTGGGACTGGTT AGG (reversed) Intergenic