ID: 936146947

View in Genome Browser
Species Human (GRCh38)
Location 2:109986644-109986666
Sequence GCTGGGGCTGGGCCTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146947_936146956 -5 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146947_936146952 -9 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146947_936146964 23 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data
936146947_936146965 26 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146947_936146962 11 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data
936146947_936146963 16 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146947_936146960 8 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146947 Original CRISPR GCTGGGGCTGGGCCTGGGAC TGG (reversed) Intergenic
No off target data available for this crispr